Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1166
Length(NT) : 828
Best Gene Model Blast : Link to GSTUMT00007790001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein FG01923.1
Accession: ref|XP_382099.1| Score: 516 E_value: 1e-50
KEGG Definition: hypothetical protein
Accession: fgr:FG01923.1 Score: 516 E_value: 6e-51
KOG Definition:
Classification: [Cytoskeleton, Signal transduction mechanisms].
Kog Number: KOG2675 Score: 505 E_value: 6e-52
PFAM Definition: CAP_N, Adenylate cyclase associated (CAP) N terminal..
Pfam Number: pfam01213 Score: 541 E_value: 4e-56
Swissprot: P36621|CAP_SCHPO
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0003779 = Molecular function: actin binding
GO:0008179 = Molecular function: adenylate cyclase binding
GO:0009267 = Biological process: cellular response to starvation
GO:0000747 = Biological process: conjugation with cellular fusion
GO:0045761 = Biological process: regulation of adenylate cyclase activity
GO:0030437 = Biological process: ascospore formation

Sequence:
>Contig1166
TTGGCAACCCCCAATATTGAGTTATCTGCCGTATGGCTCACCCAGTTCAG
ATGAACAATCTGACGACTCTCATCAAACGCCTTGAGGCTGCTACCTCCCG
CCTGGAGGATTTAGCATCAACTCCCGTTGACCTTAATTCCGGTGCAGCTA
CTGCGCTTCCTAGCAATACCAGCGCGGCTTCTCTGGTGTCAACTACTACA
ATACAAAATCCACCTCCGCCAGCTCCAGAGCCGCTTCCTGCGTCTGTTGA
GGACTTTGACGAGTTGATAACTAAGGAAGTCGCAAAGTATGTTGAGAAAA
GCGCTGAGATAGGTGATCTCGTAGCAGAACAGAGTAAAGCTGTCGAGAAA
TGCTTTGCGGCTCAGAGAAAGTTTCTCGTTATCACAACCAAGGCGAAGAA
GCCAGGATCGTCAACGCAGCTATTTGTCGACCTCGTCGCTGAAATGCAAA
CTGAGCTTACCAACGTCTCCAATATCCGTGAGAATAACCGACACTCTGCG
CTCTCCAACCATTTGTCGACTGTTAGCGAAGGTATTCCCGGTCTTGCTTG
GGTAACCGTTGAGGGAAAACCGGCAAAATATGTCAGAGAAATGCTGGGTG
CTGCGCAATTCTTCGGTAATCGTGTGATCACTTCGCACAAGGAAACGTCT
CCAAAGCATGTTGAATGGGTGCGCTCGTTTTACACTGTTCTGACGGCTCT
TGAAACCTATGTTGCCGATCACCATGCTCTGGGAGTGACATGGAATGCTA
GAGGCATCGATGCCAAAGAAGCACTTACACTCGCAAGCAGCTCTTCGGCC
ACCTCGCAAGGCCCCACTCCTACTAGTG

Sequences in the Contig:

SY0AAA43YJ21FM1 SY0AAC6YA07FM1 SY0AAD56YK22FM1