Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1165
Length(NT) : 1571
Best Gene Model Blast : Link to GSTUMT00007143001 E-value : 1e-148
Numbers of ESTs : 7

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001272352.1| Score: 197 E_value: 3e-13
KEGG Definition: hypothetical protein
Accession: ncr:NCU06641.1 Score: 178 E_value: 2e-11
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1165
TTGGCCAGGGCGCAACGTGACTGCATCCCACCTTTGCCCTCCTCCCCTCC
CACTCCCCTCAGTCACCCTCGCATAGCTTCCCTACGTCCCTACTTTCCCT
ACACAACCAAAACTGGCCCGGGGAAAAACTTACCGATGACTGCTGTGTGG
AGCCCGCGATGACTACATTGCGATTTTTTTTTTTTTGCGAGGTAGGCTGT
GCGAGTTCTGGGACTTTGCACCTCAACTTGTTTGGGATCGAGCAGATGCA
TGTCCTGTCCAGATCATTCAGTGCACGTTCCACCTCCCAAGACCGATTTC
CATAGTATGCCGAGCTCTGCAAGTGGCTTTTTGGTGTATATAATGCTCGT
GGTTTCGCCGCCATTGTGCTCACCTCGTTCTTCGCCGCACACCAATCTAC
ATTCGCTACATTCGAAAAGCATTTAACTTCTACTCCCTCAAATACATTCG
ATTCACTCATTCATCGTCCTTCTATACAGCTTCTACTACCACTTTTACTC
TTTCTAATTCCCTTTCCTTCAGGAATCGCATACACCAGGCGATACTTGGA
GCAGATATTCAATTGCAGTCGCTCACACTCAGTGATTCTTTACCTACCTC
TACCTAATTTTTACCTTCTTTAAACTTCAAGCACTTTTTTTTAAAAAAAA
CACCCTTCAATATGTGCATGAGAGTTGTCGAACGCTATGCTGTGTGCAAG
TGCGTCTACTACACCCATGGTATCGATCAGTGCTCCGCATATGGTCGCCG
CGGCCACTCCGTTCAGGACAAGACCGTCCTTGTCGGTCATACCTGCCCCG
ATCATTCGGGCGCCAATTGGGCCACTGGCCCCGCTCCCAACTATGGAGGT
TTCCCGGGAAGCAGCAGTACCGGCGGTTTTGGCGGTTCGGGAGAATCCGG
CCGCTACAACGTTCACTGGCGGTAAACCCGCATTCAATTCGACAAGTTAT
CCGGCGGTCCGGCTGGGAAGGATCTCCTCAACTGAATTTTCTTGAATTGG
CATTTGGGGATACGGAAGGTGGAGGGGGTGGGATGGTAGAGGAATGGGCT
GGGGGAGGGTAATGGAAGTGAACGGAGAACATGAGCACCATACCGGTATA
AAGAGAGGAGAGAACGCGGGGGGACATTGACGAGCCGAAGATCCGAATTC
CGACATGGTTTTTTTATTTTTCACGCATCAGTCGAAATCCGTGGAAATAT
CTTATTGCGGTTTCGATTTGTTCGAGCGGTTTACGATTCACGCGGGACGC
GGAAAACTTGTTTCTTCATAGCGTGGGAATGTTTTACGCAAACGTTTACG
AGGCATTTTTCGATACACGATTGAATGGGAAATGACATGGGTTTCTTGGT
TTTCCTTGTTATCATTTTATTTTTATTTTTATTTTCACCCTCTAATGGAT
ACTAGTAGGGCAAAAATTGGAGCTGTCGGAGTCTTTGGTTGGGGAGTTTT
TCTTCTTTCATTCTTTCTGGTTGATCGCTACTTTGCATCTCTCCTTTGTC
TTCTTTTCATAACTTTGTTATACCACAGGACTTTTTTTTTATTTTTTTTT
TATTTTTTTCACTTTAAGGTG

Sequences in the Contig:

SY0AAA12YH21FM1 SY0AAA13YM07FM1 SY0AAA36YC18FM1
SY0AAA43YI16FM1 SY0AAA57YO20FM1 SY0AAB20YG18FM1
SY0AAD47YK14FM1