Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1164
Length(NT) : 645
Best Gene Model Blast : Link to GSTUMT00001125001 E-value : 1e-96
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1164
TTGGCCTATACGGACACAGAATCGATCGGAACTTGTCAAGCCCAGATTAG
AATGCACCCAATTCGGATCGACCAACCCGAATAACTCACTCACTCCTAAA
GGTTCCTTCCTCCAAATCCGGCGTCGCACATCACCGTCCGTTCGTTCGTC
CCCACGTGCCGTGACACCTGTGGATCGTTGAACCCAACTGAAACGCGGGA
GCGGAGTGGAGCGGATTGGAGGGGGGGCGAATGCCCCACAATAAAACGGG
GTTACGCAGTACGGCACATATCATACATGCGCACGAAGCAAGTACGAGTA
CACTATGATACATACATACAAAGCGGAACTGCCGACAAAAAAAAAGTCGG
GAATACAAACTATCATAACAAGCCAACGGAAATATGATTGTTGTACAGTT
AATTGTTAACATGCAGGTAGGCAGGCAGGGCAAACGGGACGGAAGGAGGG
AAGGAAGGACGGAAAGCCCCCAACTTTATTATGATATTGTATGTGTCCGA
TCCCGATGAATAGATAGATCGATGCAGGGTGATGGGTGGTGAACCTATGA
GTGAGTTAAAGCGAGTGAGTGATTAATCGAGAGCGAAATGCAACGGGTTC
CGCGTGTCGTTGGGGATTGATAGGGTGATTGGTTACCGTATCATA

Sequences in the Contig:

SY0AAA31YO02FM1 SY0AAA43YI13FM1