Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1163
Length(NT) : 884
Best Gene Model Blast : Link to GSTUMT00000154001 E-value : 1e-102
Numbers of ESTs : 2

Blast Results:

Nr Definition: CSL family zinc fnger-containing protein
Accession: gb|EDP50424.1| Score: 273 E_value: 2e-22
KEGG Definition: CSL family zinc fnger-containing protein
Accession: afm:AFUA_4G10520 Score: 267 E_value: 5e-22
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG2923 Score: 268 E_value: 2e-24
PFAM Definition: zf-CSL, CSL zinc finger. This is a zinc binding motif which contains four cysteine residues which chelate zinc. This domain is often found associated with a pfam00226 domain. This domain is named after the conserved motif of the final cysteine..
Pfam Number: pfam05207 Score: 215 E_value: 3e-18
Swissprot: Q6C0G3|DPH3_YARLI

Sequence:
>Contig1163
TTGGACTCCGCATAACAAACACAAAGGGGAACAACGCAAGACTCACAGCC
TCAAATATCACCCGAATCATCAAGGAACAGCTCGGACACACCGCGATTTC
CTCCCCATCGCGCAGGTCATCCAGCAGAATTTCGAACCTGTCACCGCACG
GACAAGGATATGTATATAGGCCGCGGTCCTTGTCGAAGGTCATGTCTTCG
ATTTCTATCTCGTCGTAAATCGAGTCTGTCATGGCGGCGGTTATGGTTGC
GGTTGGCGGTGTGAAGTTTGAGGTCAAGCTAAGAGTAGGAGGGGTGGGCG
CGGTTTTTTTTGTCAGATGCCACGTGCGGTGGTTGCTTGGCTCAGTATCG
TAATGCTTTACCAGTACTTGAGTGCTTGGGGTTGCCAGTGGCAGGGTACT
AAGTTTAATCCACCCCAAACTTACAGCAGTGCGGCGGTATGGCGCCTGTA
TCTGGCATAAAGCATGATATCTGAAAACGAGGCAAGCTCCATCCTTGCTG
ATGGGAGGCCGTCTAAACATAGCCGCACTCTCAAATACCGGTACTCATCA
CAGGTATACAAGGCTACAACTACGACCACTAAATGAACCCCTCTCACTAT
CCCACCACCCAACAACAAATGTACGAACCCCAACCCCCAATGTCCGCCGC
CCCCACCGCCATTCTGGGCCCCGCGCGGGAGGGGGGAGAAGACGTGGCGA
GACCCACCCCCCCACCCGGGAACGTGGACTCCGGGCCGACCTCATCGTCG
GATTGTCTGCACTTCCTGAACACCTGCCTCACCGGCGCCGTTGCGATGGG
GGAGGGCGTGTTCGCGTGCTGTGGATGCTACTAGTACTGTTCACCGTGTA
ATTGATTTGCGATTGTGATGGGGGGGGGGTTGCT

Sequences in the Contig:

SY0AAA43YI10FM1 SY0AAA56YF04FM1