Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1161
Length(NT) : 1118
Best Gene Model Blast : Link to GSTUMT00008926001 E-value : 0.0
Numbers of ESTs : 41

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001557982.1| Score: 592 E_value: 3e-59
KEGG Definition: CaO19.9232; hypothetical protein
Accession: cal:CaO19_9232 Score: 587 E_value: 6e-59
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG4472 Score: 768 E_value: 3e-82
PFAM Definition: Glyco_transf_15, Glycolipid 2-alpha-mannosyltransferase. This is a family of alpha-1,2 mannosyl-transferases involved in N-linked and O-linked glycosylation of proteins. Some of the enzymes in this family have been shown to be involved in O- and N-linked glycan modifications in the Golgi..
Pfam Number: pfam01793 Score: 825 E_value: 7e-89
Swissprot: P46592|MNT2_CANAL

Sequence:
>Contig1161
TTGGGGAGGAAAGAGTCAGACAGTAGCACCAGTATAATAAAACATCTCCA
ACACAGCCAGGTTCGCACCAACGAAACCTAGAGATATCAGCCCGCCTCGC
TCTAGTACAGTTCTGTATTCCAGACAACACCGCGCCCATCCCATCACAGC
TTCTCCGCGCGGTACCGTATTATGATAAGTTAGCAGAGTAAGGGTCCCCG
CACTCGCCCTCCGCCCAAGAAATTTGCAGGCTCTGGCTCTCCTCTCTCCC
GCGGCAAGAATGGATCCAAAACTCCTCTGGCAGCGTGCGGACACGGGCTC
CCGAATCTCTGCACGATTTTTCACTCGTCGACTATCCCTGCGCGTCCTCG
CTCTGCTGTCAATCTGCGTGGTACTTTACAATGTTGTCTACAGCACCGAG
CTGCGGAGACGACTGGAGATGAATGTCCAAGCACCGAGGCATACGGGTCA
GCCTCAACATGGGACAGATACAGCTGAACTGGAGGATGGCCCCCCGAGCG
CAACCTGTTTCGGCGCCGAGCTCGGGCATAATGGAACCGAGAAGGCGACC
CTGGTTATGCTCGTAAGGAATAGTGAGCTCCACGGGGCCTTGTCTTCTAT
CAGGATGGTCGAGGATAGGTTCAATAGACGATTCCACTATCCGTGGACTT
TCCTTAACGACAAGCCATTCACCGACGACTTCATCAAGTACACTTCCGGA
CTCGCCAGTGGCCCGGTTGAATACGCCGTCATCCCGGAGGATGATTGGTC
CATTCCCGACCATGTAAACACGACAATTATGAGAGCAGAAATGTTGCGGA
TGGCAAAACAGGAGATCATCTATGGCGGTTCCTTATCTTACCGACACATG
TGCCGATTTAACTCGGGATTCTTTTACAACCAAGAGGTCATGAGGAAGTA
TGATTGGTACTGGCGTGTTGAACCTGGAATCGAGCTCTACTGCGATATTA
ATTATGACCCATTCACTTTCATGCGGGAGAACAAGAAAATATACGGCTTC
GTAATTAGCATGTACGAATTCAGGGATACCATCACGACACTTTGGGACAG
AACGAGACAATTTGTGGCGGAAAATAGTCAATTCCTCCACGCAAACAACT
CCCTGGACTTCCTTGTCG

Sequences in the Contig:

SY0AAA15YL15FM1 SY0AAA16YF10FM1 SY0AAA17YI15FM1
SY0AAA23YH18FM1 SY0AAA24YC18FM2 SY0AAA27YD11FM1
SY0AAA29YB01FM1 SY0AAA30YG14FM1 SY0AAA33YJ20FM1
SY0AAA38YG02FM1 SY0AAA38YO08FM1 SY0AAA43YG19FM1
SY0AAA43YJ03FM1 SY0AAA44YF16FM1 SY0AAA44YJ09FM1
SY0AAA48YG11FM1 SY0AAA49YJ02FM1 SY0AAA4YK04FM1
SY0AAA50YP12FM1 SY0AAA54YH16FM1 SY0AAA54YK19FM1
SY0AAA55YA04FM1 SY0AAA58YF14FM1 SY0AAA61YA07FM1
SY0AAA9YO07FM1 SY0AAB11YD21FM1 SY0AAB18YK08FM1
SY0AAB28YH18FM1 SY0AAB2YO20FM1 SY0AAB30YL06FM1
SY0AAB34YL02FM1 SY0AAB35YK20FM1 SY0AAB38YA07FM1
SY0AAB43YJ22FM1 SY0AAB46YF07FM1 SY0AAB46YN03FM1
SY0AAB48YA17FM1 SY0AAB52YL21FM1 SY0AAB54YB09FM1
SY0AAB58YG09FM1 SY0AAB59YM10FM1