Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1160
Length(NT) : 1159
Best Gene Model Blast : Link to GSTUMT00009828001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein SS1G_12594
Accession: ref|XP_001586607.1| Score: 330 E_value: 8e-29
KEGG Definition: hypothetical protein
Accession: fgr:FG06914.1 Score: 304 E_value: 4e-26
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG3689 Score: 198 E_value: 3e-16
PFAM Definition: PDEase_I, 3'5'-cyclic nucleotide phosphodiesterase..
Pfam Number: pfam00233 Score: 170 E_value: 6e-13
Swissprot: Q23917|REGA_DICDI

Sequence:
>Contig1160
TTGGGGAGAAAGTTCTGAAGGATGGTGGAATGGACTCGTTGAAAGACCAG
GCTATCTCGGATTATAGGACCCTCGTCTGCGCTCTGCTAATCAAGTGTGC
TGATATTAGCAATGTGGCACGAACACATGAGTGCTCTTCCCAGTGGGCTA
AAATTCTGATTGAAGAGTTTGCCCGCCAGGCGACCATGGAAAGTGATCTT
GGAATATCATCATCACCGGTCGCTCCGCCTGTCACTGGGTCTGTTCTTGC
CCTTGCAAAGTCACAGGTGGGATTTATGACTTTGTTTGCTTTGCCTTTAT
TTATTTCCTTGAGCGAAGTTCTGCCAGAGATGCAGTTCAGTGTGGATGTC
TTGATAGCAAACAAGGCGATGTGGCAAACAGAGATCGAAACCATCACCTC
AGCATCGGATGGAATCGTGGATAAGATGTTTGGCAACAGCAATGGACCGG
CGCCGGGATCGCTATCGACAAGCGCCGGCAGTAAGCAGGGTGGTGAAGAT
TTGGGGGACGGTCGGTTGGGCGGCAGCCACGGAACGCATGTTCTAGGGCC
AGTGGTAATGGAGTCGTCTACCACTTTCCAATCATCAGGTAATCTTGGTG
GAGGTGGAAGTGAGGCGCGCTTGAATGTTCTGGCTCTTGAACCAGGCGTT
CAAGCGTCGGCTGAACAGCCTACGGTCACGGTTGTGGTGACGCAACCGAA
AACGCTCTCGCCTGACCCGCACGCGCTCCTCGACGAGAAGAGGCCCACCC
ATCAGTATTCATCCGAACATCTTGGAACCCAGGAACCCCCCGAACAGGAC
ATCCCCGATCGCCCCAGGTCGAGCCCACCGGATCTGGGCGACCACTCGAG
TGAGCACTCGTGCTCGAAGGCCTGCTGCGGACCGACGGCTGTTGTGTCGA
CAAGCACGATACAGCGCCGTCCGTCCAGCTTTTTCAAGAGAGTCAAATTA
TGGAAGAGTTGGCGGAAGGAAACAAGTGAAGCATGACTACATGGCAGTGA
CAATAATAACCACGGCGATGGCAAAAACAATAACAGTAGCAATGGTAATG
GCAACAAGGAGGGCACGGGGGGGATATTCTTTGATTCAAAAGCAATATCT
GTGCAAGAAATCTCGTCCCCTCTGACCCCAACGCATCCACTCGCTCCACC
GCCCTTCGA

Sequences in the Contig:

SY0AAA20YL03FM1 SY0AAA43YG05FM1 SY0AAB47YE12FM1