Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig116
Length(NT) : 1589
Best Gene Model Blast : Link to GSTUMT00008763001 E-value : 0.0
Numbers of ESTs : 48

Blast Results:

Nr Definition: eukaryotic initiation factor 4A
Accession: ref|XP_001561381.1| Score: 1769 E_value: 0.0
KEGG Definition: hypothetical protein; K03257 translation initiation factor eIF-4A
Accession: mgr:MGG_04400 Score: 1763 E_value: 0.0
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG0328 Score: 1605 E_value: 1e-179
PFAM Definition: DEAD, DEAD/DEAH box helicase. Members of this family include the DEAD and DEAH box helicases. Helicases are involved in unwinding nucleic acids. The DEAD box helicases are involved in various aspects of RNA metabolism, including nuclear transcription, pre mRNA splicing, ribosome biogenesis, nucleocytoplasmic transport, translation, RNA decay and organellar gene expression..
Pfam Number: pfam00270 Score: 428 E_value: 1e-42
Swissprot: A6RJ45|IF4A_BOTFB

Sequence:
>Contig116
TTGGATCAACTTCGAATTTTCACAACGCATCAAGAAAAAATAACCACCAT
CCGTAGTACTCATTCCTTCTTATAAGGGGACTACTACAGATACCTTTTAC
TGCAAATACTACCATCTACCGCTCGAAAAACCTCTCCACTCCTCTATTAC
ACCTTGCCCAGCATGGCTACAGAAGGACTTAAGGATGTTGAAGGACAAAT
TGAGTCCAACTACGATGAGACTGTCGACAACTTTGATAGTATGGATCTGA
AACCTGAGCTTCTCAGAGGCATCTACGCATATGGTTTTGAGCGTCCCTCT
GCCATCCAACAGCGTGCCATCCTCCCTGTCATTAATAACCGTGATGTTAT
CGCCCAGGCCCAGTCTGGAACTGGAAAGACCGCGACTTTCTCGATTTCTG
TTCTTCAGAAGATCGATTTGTCTGTCAAGCAATGCCAGGCTTTGATCCTA
GCCCCTACCCGTGAGCTCGCTCAACAGATTCAGAAGGTTGTTGTTGCTAT
TGGAGATTTCATGAATGTTGAGTGCCATGCCTGTATCGGGGGAACTGTCG
TCCGCGAGGACATGAAGATTCTTCAAGACGGCGTGCACGTCGTTGTCGGT
ACTCCTGGTCGTGTCCATGACGTGATCCAGCGCCGCGCTTTGAAGACTGA
TGCTATCAAGCTATTCGTCCTTGACGAGGCTGACGAAATGTTATCGCGTG
GTTTCACCGAGCAAATTTACGATATCTTCCAATTGCTTCCCCAATCCACC
CAAGTCGTTTTGCTCTCTGCCACCATGCCTCAGGATGTTCTTGAGGTCAC
CACTAAATTCATGCGTGATCCTGTCCGCATCTTGGTCAAGAAGGCCGAAT
TGACGCTCGAAGGTATCAAGCAATTCTACATTGCTGTTGAGAAAGAAGAC
TGGAAACTCGACACACTTTCCGATCTCTACGAGACGGTTACAATCACCCA
GGCCGTTATTTTCTGCAACACCCGTAGAAAGGTTGACTGGCTCACTGAGA
AGCTTACTGCCCGTGACTTCACCGTTTCCGCTATGCATGGAGATATGGAT
CAGCACCAGCGAGATCTCATTATGAAGGAGTTCCGATCTGGTTCTTCCCG
TGTGTTGATTGCTACTGACCTCTTGGCCCGTGGTATCGATGTTCAACAAG
TCTCTCTCGTCATTAACTACGACTTGCCTGCAAATAGGGAGAACTACATC
CATCGTATTGGTCGTGGTGGTCGTTTCGGCCGCAAGGGTGTTGCGATCAA
CTTTGTTACAGCTGACGACGTCCGTATGATGCGTGAGATTGAGCAATTCT
ATTCTACCCAAATCGAAGAGATGCCAATGAATGTTGCTGATCTCATCTAA
ACAATTTTCATAATTTCAACTAAATAAAAGTTTTTTTCTTTTTCTTTTTT
TTTTACCTGGTTTCCTATGACCTTCTCCCGTTCCGGGTTTATGATTTCCT
TTTCTTTTTTTGTCTTAGTCCTTCCTGATTCTTTCTGTATGCGTTCTTCA
TCTGGGTTGGGAATCGGCTATCACATCGGGACAGGACTGTGTTTTCATTT
TCTCCCTAAAGGGGCAGTTTTCGAATACCTGAATGGAAA

Sequences in the Contig:

SY0AAA13YA09FM1 SY0AAA14YE22FM1 SY0AAA1YF23FM1
SY0AAA21YG20FM1 SY0AAA28YD23FM1 SY0AAA2YN10FM1
SY0AAA37YF01FM1 SY0AAA46YL13FM1 SY0AAB18YO15FM1
SY0AAB28YK02FM1 SY0AAB28YO15FM1 SY0AAB31YE06FM1
SY0AAB32YC23FM1 SY0AAB33YE22FM1 SY0AAB38YO06FM1
SY0AAB45YJ05FM1 SY0AAB46YD06FM1 SY0AAB54YO14FM1
SY0AAC13YB21FM1 SY0AAC16YL11FM1 SY0AAC18YP03FM1
SY0AAC27YG16FM1 SY0AAC28YA04FM1 SY0AAC29YD08FM1
SY0AAC2YF18FM1 SY0AAC31YK04FM1 SY0AAC45YK12FM1
SY0AAC49YI09FM1 SY0AAC50YO07FM1 SY0AAD11YL24FM1
SY0AAD12YM16FM1 SY0AAD13YI06FM1 SY0AAD16YJ14FM1
SY0AAD19YA11FM1 SY0AAD20YC09FM1 SY0AAD22YN13FM1
SY0AAD26YA10FM1 SY0AAD27YO13FM1 SY0AAD30YL13FM1
SY0AAD35YP23FM1 SY0AAD39YI08FM1 SY0AAD39YK06FM1
SY0AAD42YB02FM1 SY0AAD55YG11FM1 SY0AAD60YC01FM1
SY0AAD6YE01FM1 SY0AAD9YB23FM1 SY0AAD9YG07FM1