Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1159
Length(NT) : 882
Best Gene Model Blast : Link to GSTUMT00004837001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: sporulation protein SPS19
Accession: ref|XP_001526807.1| Score: 569 E_value: 1e-72
KEGG Definition: hypothetical protein
Accession: yli:YALI0C03003g Score: 583 E_value: 4e-70
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0725 Score: 262 E_value: 9e-24
PFAM Definition: adh_short, short chain dehydrogenase. This family contains a wide variety of dehydrogenases..
Pfam Number: pfam00106 Score: 193 E_value: 1e-15
Swissprot: P32573|SPS19_YEAST
Gene Ontology:
GO:0005782 = Cellular component: peroxisomal matrix
GO:0008670 = Molecular function: 2,4-dienoyl-CoA reductase (NADPH) activity
GO:0009062 = Biological process: fatty acid catabolic process
GO:0030437 = Biological process: ascospore formation

Sequence:
>Contig1159
TTGGGTATGTCAAGACACCATACACTGCGCTTTCCCGTTCTCTTCACTGA
AACCTGACCTACCAACTCAACTCAAACAGAAGGCAAAGTGGTCCTCTGCA
CCGGTGGAGCCGGCTCAATTTGCTCTACGCAAGTAGCAGCACTAATCCTA
CTCGGCGCGAACGCCAGCATCATCGGACGGAGGAAGGACGTGACGGAAGC
CAAAGCCGCAGAACTCCAAACACTCCGAAGCGGTAGCAAAGTCCTCGGTA
TATCCACCGACGTGCGGGACTACTCGGCACTCGTCACGACGGTGAAGCGG
ACGGTTGAGGAATTGGGGAGGTTGGACTATGTCATCTGTGGAGCAGCCGG
CAATTTCCTGGCAACGGTTGACAACCTATCCGTCAACGCGTTCAAGTCTG
TTATCGACATCGACGTTCTGGGTTCGTACAATACGGTGAAGGCATCACTG
GAGGAACTCAAGAAGACCCGCGGCAAGATCATATTCGTCTCGGCCACGCT
GCATTATACCGGTTCGCCGTTCCAGGCTCATGTTTCTGCGGCGAAGGCCG
CCATAGACGCACTCTCGCGCGTGCTGTGCGTGGAGTTGGGACCTTATGGG
ATTACTAGCAATGTTTGTCCCCTTCCCCCCCACCTCGCATTGCCTTGCGG
GGGGAGGAATCATTGAATTAATTAATGAGAATCTGGGGGGAATGCAGTGC
ATAGCTCCAGGCCCCATAGCCGGCACGGAAGGCATGGCCAGACTGTCTCG
TCCAGAAGTCGCTAGTGGGGCGGAAAGGGCAATTCCTATCCAGCGGTTGG
GCCATGTTCACGAGATTGCCGATGCCACGATCTACCTATTGTCGCCGGCG
GGAGACTACGTTAGTGGCGATGTGATTGTTGT

Sequences in the Contig:

SY0AAA30YO04FM1 SY0AAA43YF16FM1 SY0AAB43YM15FM1
SY0AAB5YO12FM1 SY0AAD26YO11FM1 SY0AAD55YL05FM1
SY0AAD61YA16FM1