Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1158
Length(NT) : 1856
Best Gene Model Blast : Link to GSTUMT00007732001 E-value : 0.0
Numbers of ESTs : 12

Blast Results:

Nr Definition: hypothetical protein CIMG_09493
Accession: ref|XP_001239872.1| Score: 536 E_value: 2e-52
KEGG Definition: RRM domain; K03258 translation initiation factor eIF-4B
Accession: aor:AO090102000222 Score: 510 E_value: 1e-49
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG0113 Score: 161 E_value: 1e-11
PFAM Definition: RRM_1, RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain). The RRM motif is probably diagnostic of an RNA binding protein. RRMs are found in a variety of RNA binding proteins, including various hnRNP proteins, proteins implicated in regulation of alternative splicing, and protein components of snRNPs. The motif also appears in a few single stranded DNA binding proteins. The RRM structure consists of four strands and two helices arranged in an alpha/beta sandwich, with a third helix present during RNA binding in some cases The C-terminal beta strand (4th strand) and final helix are hard to align and have been omitted in the SEED alignment The LA proteins have a N terminus rrm which is included in the seed. There is a second region towards the C terminus that has some features of a rrm but does not appear to have the important structural core of a rrm. The LA proteins are one of the main autoantigens in Systemic lupus erythematosus (SLE), an autoimmune disease..
Pfam Number: pfam00076 Score: 152 E_value: 1e-10
Swissprot: O14369|SCE3_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0000917 = Biological process: barrier septum formation

Sequence:
>Contig1158
TTGGCGACAAACAATTTTTTCCCCCTTGCTAAACGGGCAGAACAGTCCTT
TTAGCGTATTCATTATCAGCAAGCGCGCTTCCCATATAGAGCGCGTTCGC
TGTTCTCGCAATCATGGCGCCGCCAAAATCGAAAGGCCAGAAGATGGCTC
TGGGAGATTTCCTTCAAGATGAGAGCTTGGGATCCTGGGCTGATGAAATG
GAGGACATGCCCACCATCCCCTCTGAAAACCGCCCCGGAGCTGTATATGG
CAACCGTCGTGATTATGGTGGAAACAGTAGCTTTGGTGGAGGTAACCCAA
GCAGAAGTGACCGCGAGGACCGTTACCCGCCTCGCCAGGCTATCCCGCCC
CCCGACAAACCCCCCTTTACTGCTCATGTTGGGAACCTATCCTTCGATGT
GACCGAAGCACAGATGTCCGAGTTCTTTAGCTCCTGCCAGGTTGAAAACG
TCAGGCTTGTTCGCGATAGAATGGATGACCGTCCTAAAGGGTTTGGATAT
GTCGAGTTCAAAACTAAGGAGGGGTTGATTGCCGCTGTCAATATGAGTGG
CGAAGTGTTTTGTGGTAGGGGTGTGAAAGTTAGCGTCGCTGAACCACAGA
AGGATCGTGGTGATGATCGTACCCAAGGAGAATGGCGTCGGAGTGGCCCT
CCTCCCCTTGCCGACCCCCCACGCCGGGGGAGCGAGCGTGGTGATCGTCT
TGGTGATCGTTTTGGGGAAGGCGGAGACCGTGGCGATCGACGCCACAGCT
ACAATGATGCATCTGAGAGAGCGCCTCCCCGCGAAGCCCGGGAGCTCGAC
TGGGGGAAAAAGACGGCTCTCCCTCCTACACCCACTGCAAGTGAGCATGG
TGGTCGTCCTCGTAGTGGGGATCGTGAATATAGAAGGCGTTCCCCCGCAC
CGGCTGTCCAAGAACCGCCTCCTAGGAGCACTCCTGCCAGTCCTGTCGTC
CCTCATACCCGTCCTAGGCTAGAACTCAAGCCTCGAAGTGAACATCCCGT
TGAGCCTGGGCCAACTTCTGCAGCGTCTACTGGTGAATCATCAAAGGCAA
ATCCGTTCGGCGCAGCTAGACCTATTGATACATCCCAGAGAGAAAAGGAG
GTTGCGGAGAGGAGAGCAGCCGCCATTGCTGCTAGGAAGGCCAAAGAAGA
CAAAGCCCGCGAAGAGAAGAAGGCCCGCGAGGCCGAGAAGCAAAGCGAAG
CTGGCACCCCGACCGGAAGCAACAAAAACTTTGCGCTTCTCAGAAGAGCG
TCAACAGGCCCTGAGGGAGCTGCTGCAGACGGCGAGGGCGAAAAGGAAAA
AGAGGCTAAGATAGAGAAGAAGGACGAAAGGCCATCCAAGGTTACAGCGA
GCAGCTGGAGGGCAGCCAGGCCGGAGCCAAAGGATAGGGATGTTGCGAAG
GAGCCTAAGCTTGACATTAATAGGGCCTCCAATTCCGCAGCAACTGAGGA
GGACACCGATGGTTGGACTCCAGTCTCCGGCAAGCGGGGGCGCGGAAGTG
CAAATGGTACAAAATCTTCGACAGGTTCTTAAATGCTGTGTATTGTGGGT
GCTTTCTTTCTTTTTTTTTTTAATCAAAAACGGAAATTTAAAAGCGTGTT
TCTATGTCTCTCCATTACTTGTTATTCTTTTCTTATGTCATTTTCTGCTT
CGCTGTTCCCTTCCCCTTCGTCCCCTATCGCCTTCCCTCTTCCCTCTTCA
CATTTTCTTTTCTTTTTGGAATCACAAAGCTAGAGCGTTGGGTCTTTTCC
TCCTGTTTTTTTTTTTTTCCTTTTATTATTCTCTCTCACTTGATGATGGC
TGGGGAAAAAAAACGTACTTGGAAAAACCAAAAATAGTCTCGGGTCCCTT
TTCATG

Sequences in the Contig:

SY0AAA16YF11FM1 SY0AAA36YK06FM1 SY0AAA43YF11FM1
SY0AAA50YL11FM1 SY0AAB1YC02FM1 SY0AAB20YP07FM1
SY0AAB31YL24FM1 SY0AAB35YO17FM1 SY0AAB39YK17FM1
SY0AAB41YL16FM1 SY0AAC23YB20FM1 SY0AAC37YD07FM1