Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1157
Length(NT) : 2748
Best Gene Model Blast : Link to GSTUMT00007385001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: hypothetical protein SNOG_01283
Accession: ref|XP_001791929.1| Score: 765 E_value: 1e-119
KEGG Definition: hypothetical protein
Accession: ncr:NCU08517.1 Score: 557 E_value: 7e-95
KOG Definition:
Classification: [Transcription].
Kog Number: KOG0260 Score: 165 E_value: 6e-12
PFAM Definition: Tymo_45kd_70kd, Tymovirus 45/70Kd protein. Tymoviruses are single stranded RNA viruses. This family includes a protein of unknown function that has been named based on its molecular weight. Tymoviruses such as the ononis yellow mosaic tymovirus encode only three proteins. Of these two are overlapping this protein overlaps a larger ORF that is thought to be the polymerase..
Pfam Number: pfam03251 Score: 138 E_value: 9e-09

Sequence:
>Contig1157
TTGGGTGTTTTTTTCCAGCAGCTTTGCTATTGCCGGGAAAGAAAAAAACG
AAGCCCCTCGGCCTTTGGACATGAAGCCCTCCTCATCAACCTCTTCGTCA
AAGTACCGCGTCCATTCTCCATCGGATACAGTGCCCCGCTCTCATTCGGC
ACGGAGCAGGGGATCGGGCTCGAGAAATATAGGGGACCCACGAGACCAGC
AAGTAGCTACTTACTCACCTTCGAGTACTCCCGCATCGGATTATAATTTA
TACGACGCTCGGGGGTATCCCGTTCAGCCTTATTTGGAGCACCACCCTTC
ATATCCGAGCCTTCACTCATACCCGCCTCCACCTCCGCATAGCCATGGGG
TCCTTCCTCCTCACCAACACCCCTCATACCCAACCTCTCACCCCGTGCAA
CCCCAGGCGTATCACCCCACGTACCCGAGCTATGACTCACAACAAGCGCC
TCTGGCCCACCCACAGCACCCGTCGTATTCCAGCTCTCAATCCCTAACCC
CATATTCGAGTGGCAATTCGCATGCCCAATCTTCCCACTCCCACCATCCT
TCGCATGATAGCGACCTGTCTCAATATTCGCTTTCGGGTTACAAACTTAG
ATACCGGATCGAACAGGAGGGTCAAAATCTAGTGGTTTTACCATCAGAGG
ATGATCACCCTTCCTCTTCATCCTCATCCCGGTCTTCTATGCCCATATCT
GTCTCCCCATCACCCTCGCCTCCACTACAGCTATGTCTTCCGGCTGCCGC
TGTTCCTCAACATAATGTTCGGGCAATTAGGGCACCTCCCCGCGAATGGC
CGCCCATTCGTTACCAGACGGAACTTTCCGCGACAGAGGCTAAGAAATTC
ATCGGCGATGGAGCTCCTAAGTTTTGTGGAGAGTTGCGAGAGATTACAAA
CGGTCCAAGGGGTTATTACTATCTCTTCGCATTTGCCGGGGATGAGTGGG
ATGAGGAGTCAGACACTGCTCTTTTCCAGAGTGATTCGTTTTGTGATATG
AGCTCTAGTCCAGAGGGCAGGCAAACTGATGCCCTGGAGCGGCCAGCTAT
GGCACACGCATTTGGGATATACCCGGGAACTATAACACTATCTTGCTATG
TTACTAGTTTCGGTAGCACCCTGCAGGGACACGAAGTGGCTGCACGAGGG
AAGGTTCGGAAGCTAACAATGTTATATGTTCTTGACCGATTACGGATTTT
ACAGGTGAAGGGGATCGAGGAGGACCTTGGGCAGCTTCACATGCACCTTT
ACGACTACTTGCTCCACGATACTCATAGATATGATTCAAAAAACCATGTA
TCTCTCGACAACCAGATTTCAGACCTCGTTGCAGCTTTGTGCCGGCCCAG
CTGGGTAAATTTCTCGAGTTCCGAAAACCAGACTATTGCGCGATTTCTGT
CAGATCCTAACCCGGGCGTCGCCAATAGCTTTTTCCACCAGCTACTACTT
TCCATAGAATTGTACCTAAGAATCAATGCTAGGCATCAAACTAACTTGGC
TGCGAAGCCACTGCCGGATATGCCAGGGAAGATTAGATGGGATTTAATGC
TTGCCCAGCGATGGCTCGAAAATGTGGAGGTAGAGGCACCGAAAAAGGTC
AAAGACGGTAAGGGGAAGCGAGAACAGAAGTCCAGCGTTGGGTTCAAATT
TCCGCACAAAAAGACCCAGGTCGAAGCCTTACGGAACTTTGCATGGACTT
TGAAGTGGCCGAACATGCATGAAGTTGAATATACACTTTCAGAGGGTGAA
GATCCCAACGAGGTTCTCGAAGATAGGAGCATCAATTGTATGTCCTGGTT
CACCGGCTTGCTTCTCCCAGGCAAGTCCATGCCATGGATTCTGATGAATG
CCCTCACGGATTGCGATCCGGATGTGCCCGAAACGTTCCATAATCTTTCG
CAGACGACACCTAATGTCGGATTTCAGTACAGGGGCCACACTTATTGGTC
GTGGGAGTGCATAGTCGGCAAGGTTTTGGGGGCAGCCGCAGGTGTGGCAC
AAATCGCTGGTTGGATTGGTCCATGTTCTGCATCGGCCGATCTTAGTCGC
TCGGAAATGGCTATCATCAATCAGATGCCTCCACGAGGGAATAAAATCAC
GCCAAGCAACGTTCGAGGCATGGCCCTAATAGTGATCCTTTAGGTGCATG
CCAGACAACATATCCTGTCGACGACTATGTACTCCTCACTCCAAGCACCG
ATGACCCGGTGGAAGACATCAGGATCGAGCGTCTAAATTTCTCACCAGCA
GCAAGTAGCCCGAAAAAAGGAGTGCCCCGCATTACAGAGAATGGTCATCA
AGCTGCGGAGGAGAGCCCCGTCTTGACGTTTGACGCATCAATCACCTTTG
CGATTACCGTGGAACGTCGAACGAGGTCATGGAAGGTGTCTTTACGACAT
AACACTCCGTTCATCGCGGCTTATCCGTGTCAAAACGGGCCACACGTCTT
GTTTTGCGAGTACCAACACCGGGTTATATACGCGGATAAATTGGTGGAAA
TCCAGAACTGGGGACCTTCAGGCGGCGTGGAGGATTCAGAAGTCGATGAC
GAGGGCGGGCAGCCTGAGAACACTTCTACCGGAGTAGAGGAAGTGTTGGT
TGTCGAAGCCTTCGGAGTGCCCGACAACGAAGTCTTCGTTAGGGCTTGGT
GCTCATTCTGGGGATTGCCTGCGATTACTGCTGATGTTAACAAGACATGT
ATGGCTTGCGCGATACGGGAAGCCTACGCAGCCCTCGTAAGTGTTGTA

Sequences in the Contig:

SY0AAA29YP06FM1 SY0AAA43YE06FM1 SY0AAA44YO07FM1
SY0AAB32YM12FM1 SY0AAB58YD19FM1 SY0AAC24YM09FM1
SY0AAC33YH17FM1 SY0AAC55YG01FM3 SY0AAC58YM11FM1