Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1156
Length(NT) : 645
Best Gene Model Blast : Link to GSTUMT00011525001 E-value : 1e-106
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Transcription].
Kog Number: KOG3910 Score: 116 E_value: 5e-07
PFAM Definition: Herpes_BLLF1, Herpes virus major outer envelope glycoprotein (BLLF1). This family consists of the BLLF1 viral late glycoprotein, also termed gp350/220. It is the most abundantly expressed glycoprotein in the viral envelope of the Herpesviruses and is the major antigen responsible for stimulating the production of neutralising antibodies in vivo..
Pfam Number: pfam05109 Score: 123 E_value: 9e-08

Sequence:
>Contig1156
TTGGGATGCGCGGGGAGGAGAGGGAGTATGAGTGGGTTGAATGAGGATGG
GAGTATGGGCGTTGGTGGGGAGCGTGAAGATGACATTGGTGATTTGGAGG
GCTTGATGGATGATCCGGATGGGGATGTTATGATGGATGATGTTGGGTCT
CCTGCCGGGACGGGCGGTAATGCGGCCGCAGGGGGAGGAAGACGCAGACA
GTCACTACCCTCCCTCCGCACAGATCTACCAAATACCCCTATGACTCCCG
CGAGCGCATATACCACCGCTGCGACACCTCTGAACCCGAACAGCAGCACA
TCGACTGCCTCCTCTTCAGCAACTCTAACAGGCCGCCACCCCCATCACCT
TCACCACCACCACCCACACCATCATCCGCACCACAACACGTACCCGCCGC
CTAGCGCCCGCTCTTTAGCTGCCGTCTCGGCAACTACAAATCCCCAATCA
GCTACGTCCACTACTTCATCCTCAACCCCCGGCCAAACCGCACTCTCGGC
ATCAGCCCCCAGCCCCCCACTCTTTTCTTCTGGCATCTCTTTCAACAGGA
CTCCCGCTCCCGTCACAACTCCTACCCCTTCTTCAGCCACTGCCGCTCCC
ACCACCACCGCCGCTACCGCCACCAGCAACACGGTGCTCTCCCCA

Sequences in the Contig:

SY0AAA29YI11FM1 SY0AAA3YK02FM1 SY0AAA43YE03FM1