Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1155
Length(NT) : 960
Best Gene Model Blast : Link to GSTUMT00005384001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein CHGG_07179
Accession: ref|XP_001224835.1| Score: 149 E_value: 6e-08
KEGG Definition: hypothetical protein
Accession: mgr:MGG_03997 Score: 138 E_value: 5e-07
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1155
TTGGATCGCTTGCAGTTGGCGGTAGCAATAGCAGCGGCGCGGGGGGGAAA
GGGACGTACAGTTCAGAGTGGAAGTCGCACTTCACGGGGTCGAATGTAGC
TGGTAGTGGTAATGGTGTTGGTGAAGAGTCGGGCCAGTTGCCGATTTACC
TGTCAATATACAAGCAGAAGAACGATGTGGAGCCCGTAGTGCGATACCCG
TAAGTTTTATTATTTCCTATTTTTTCTTTATATTGGTTATCTTCAATCGC
ATCTTGCTATATCGGCGACGTAGCCGGGAGACACAAGAAAAAGTCCGTAG
TCCTACCCACGCTAGTAGTCAACCTTCGTACCGAACCAGCTCTGTCATCA
TCCCGCTCATTTCGGCGGCGAAGCCATGACATGCCGCCAAAAGATAGCGT
GAAGAGGGAATCGCCAGGAAAGGAAACGCTGCTCTTCAGACCGGGGTCGG
AGGCCAATTCGCTGGAAAGATGGGCGCGGGAAATTCAATCCTATTTAATA
CCTAGTTCATCACACTCCAACGCAACGGTGAACACTCTGGAATCTGCCTT
CCGGGAGAAATTCAGCGACCCCGATGACATACCCGGTTCATCGTCGTCAC
TGTTCATCATTAACGGCGAGCCGACCACAGCATTGCTTAGTCCCTCACTG
CGCTCGATGGCTAGTAACTTGTCAAGCATAGATTCGGATGATAACGGCAG
TCTGCTAAGTAGCCCAGCGTCGGAAATGAACTCACCAAAAGACCTGGATA
GGGCGGACCGACGGCCGAGTCTGCACATCGCGACCAAGCTCCGAAACTAC
ATGGGCCCCGCGTCGCCCGCATCGCCCGCATCACCCGACATCGCCAACAC
TAACGGCTTCCCTAGCATGCACACAGCATCCCTAAACCCCACCCGCACCA
CCTCTCCCACCGCCGATCCGGTACCCGCTCGCCGCGAGACCATCCTGGAC
CGGTTTTTCT

Sequences in the Contig:

SY0AAA43YD24FM1 SY0AAC38YK24FM1