Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1154
Length(NT) : 1421
Best Gene Model Blast : Link to GSTUMT00007443001 E-value : 0.0
Numbers of ESTs : 11

Blast Results:

Nr Definition: hypothetical protein
Accession: ref|XP_505708.1| Score: 449 E_value: 2e-42
KEGG Definition: hypothetical protein
Accession: yli:YALI0F21406g Score: 449 E_value: 8e-43
KOG Definition:
Classification: [Inorganic ion transport and metabolism].
Kog Number: KOG1578 Score: 293 E_value: 4e-27
PFAM Definition: Pro_CA, Carbonic anhydrase..
Pfam Number: pfam00484 Score: 278 E_value: 3e-25
Swissprot: O94255|CAN_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig1154
TTGGATAAATACCTTCCCATCTCGCACTTTATCTCTCGATTGCCCGATAC
ACTTCCCGAGTTCCAGATATTTTTTTGATTTCTAACGGTTTCTCGGTTTT
CCTCGTTTTCTTTTCCCCTCCTCAACCCTCACGCTTCTTCTAAAGAACGG
AGTAGTCGCCGCCATCTTCCCTTTCAGGCACGGCCCAATCAATCAATCAA
TAAATTTACATCTACTCTGCACCCAGTCCAGGTCGTCGTGTCCAAGTCTC
CAATCCCATACCGGTAGTCTGCCGTAACCGATTCCTCAACAAAAACTTCT
TTACGAAACTTATTATCAAAGCTTATCAACCGCCCACTCATCTCTCTCTA
CCCCCCCGCCGCCAGCTTAAAACCAACTTCATCATTACTCACTCTCCCTC
CCCCCTCCATTAAGAGTCCATAAACCGGTTTTTTTTTTCAATCCCCCCCC
TCAAAAAAAAAAAATTCAAATCTATAAATCCCAATATCTCTACCACTGCA
TCTTTCTCACCGCCGCACATCAACCTACCAAAATGAGCAACGACCCCTCA
ATTTTCGGCTTCACAGATGATAACATCAACCTCCTCCTGACCCGGAACAA
GAACTGGGCTCAGCGCACCAGCGCCCTCCGCCCCGGCCTCTTCCCCACAC
TGGCGAACTCGCAGCACCCTCAGATCCTCTGGATCGGGTGTAGCGATAGT
CGCGTCCCCGAGACCACAGTGCTCAACCTGATGCCCGGCGAGATCTTCAC
GCACAGGAATATCGCGAATCTACTGCCCAGCGGGGACTTGAGTTCTCTGA
GCGTCATTCAGTATGCCGTTGAAATCTTGAAGGTTAAACACGTAATTGTC
TGCGGACACTACGGGTGCGGCGGCGTTATGGCTGCGCTTGGTAATAAGAA
GTTTGGAGTTGTGGACCATTGGTTGCAGCACCTGCGTCACGTGCGTGCCG
CGAATAAAGCCGAATTGGCGGCAATCCTCTACAATAGTGCTACCCCAGAT
CTATATCCCAACAACTCACATCACAAGCTCGGATGGGCCATCGTCTGGAT
ATTAGCTACGCAGTCCATCCTGGGGGTCTTAGGAAGGACGATCCGGTTCG
CACTCTGTGCCGGGAATCTCGGTGGTACAAGGGAAGAGACCTCCGGGTTT
ATCCCGGTGCCGGCGCAGGATCCTGAGGATCATCATCATCACCGTACATT
TCAGCGCCATTCTACTGATAGTGGGCAGGGCTCGGATGAATATCGTTCTC
GATCTCCATCTACCTCATCTTTGGAAAACCGTCGTTATGGGAATTTCGAG
GGTGTGGATTTGCCGCTTGCAGAGGGGCGTGCCAACGGGAAAGTGACGTT
GGTGGAGCGCTTGACGAGTACTAGTTGGCTTGAGTCGTTCCTGTCGCGGC
ACTTGCCGTATTTGCTCGGGC

Sequences in the Contig:

SY0AAA13YP22FM1 SY0AAA21YD18FM1 SY0AAA39YB09FM1
SY0AAA43YD22FM1 SY0AAA7YD23FM1 SY0AAB1YL15FM1
SY0AAB37YD06FM1 SY0AAB40YC04FM1 SY0AAB49YC24FM1
SY0AAB56YC19FM1 SY0AAB9YM21FM1