Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1153
Length(NT) : 757
Best Gene Model Blast : Link to GSTUMT00005286001 E-value : 1e-131
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein NCU06495
Accession: ref|XP_957135.1| Score: 285 E_value: 7e-24
KEGG Definition: hypothetical protein
Accession: ncr:NCU06495.1 Score: 285 E_value: 3e-24
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG4604 Score: 186 E_value: 5e-15
PFAM Definition: DUF543, Domain of unknown function (DUF543). This family of short eukaryotic proteins has no known function. Most of the members of this family are only 80 amino acid residues long. However the Arabidopsis homologue is over 300 residues long. The presumed domain contains a conserved amino terminal cysteine and a conserved motif GXGXGXG in the carboxy terminal half that may be functionally important..
Pfam Number: pfam04418 Score: 196 E_value: 3e-16
Swissprot: Q7RYI0|U327_NEUCR

Sequence:
>Contig1153
TTGGGGGCATCGGGTTCAAAAGATTTTTTCCTCACAGACCCCCCCCCCAC
TCTGTTCTCCGCGAGAAAGAAAACAAAAGTCGGGCAAAGCAACGGATAAG
ATATCATACCGTGTCGTACTTCACTCACTTACTCATCCAATTCCATAATC
CACCAATTTCTCCGCCAGTCGGTTTAACCGTCCCCCACTCGACCAATTCC
TACTTCACTCACTCACAAGTAACTCAACTCAACTCAACTCAACCCCTTAC
CGACCTGCCGATAGATTCCTGAAACACCATGACCGCTTCAACAACTCAGC
TCGTCAAACGTAAACCAGAGTCTGAAGGTCTTTTGAACGAAAAATGGGAC
CATTGCCTTGCAAACCTCCTCGTAAAGTCCACCCTCGGCGCTGGCTTCGG
CATCATATTTTCTGTCCTGCTGTTCAGGCGTCGTGCATGGCCGGCGTGGG
TCGGTGTCGGCTTCGGTGCTGGTAGGGGTTATGCTGAGTGTGATCGGGAG
TTTAAAGGTGCGGCAGGGGGCGTGTCGAGGGCTGTTGGGGAGAGGCTGAA
GAGGGATTGATGGGGAGGGGGGTTTTTTTTTTGTGCAAAAGCTTCGGTAA
TAGACTTTGGGAGGGGGGTGGGAATTGATTGTTGGTTGTTGGTGGGGGGA
GGGGGGGGCCGTTCACCGCTCTTTCTCCTTACTCTTGCATAATTGATTTG
GTTTGATATTTACGGTGTGTTTGTTTGTCCTTGTAGTGCGCATGTGTGTG
TGTGTGT

Sequences in the Contig:

SY0AAA16YE09FM1 SY0AAA43YD06FM1 SY0AAD19YI03FM1
SY0AAD26YC18FM1 SY0AAD4YF22FM1 SY0AAD61YK07FM1