Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1152
Length(NT) : 917
Best Gene Model Blast : Link to GSTUMT00006383001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein BC1G_07148
Accession: ref|XP_001554559.1| Score: 242 E_value: 9e-19
KEGG Definition: MSF1 domain protein
Accession: afm:AFUA_2G01630 Score: 232 E_value: 6e-18
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG4462 Score: 108 E_value: 7e-06
PFAM Definition: Atrophin-1, Atrophin-1 family. Atrophin-1 is the protein product of the dentatorubral-pallidoluysian atrophy (DRPLA) gene. DRPLA OMIM:125370 is a progressive neurodegenerative disorder. It is caused by the expansion of a CAG repeat in the DRPLA gene on chromosome 12p. This results in an extended polyglutamine region in atrophin-1, that is thought to confer toxicity to the protein, possibly through altering its interactions with other proteins. The expansion of a CAG repeat is also the underlying defect in six other neurodegenerative disorders, including Huntington's disease. One interaction of expanded polyglutamine repeats that is thought to be pathogenic is that with the short glutamine repeat in the transcriptional coactivator CREB binding protein, CBP. This interaction draws CBP away from its usual nuclear location to the expanded polyglutamine repeat protein aggregates that are characteristic of the polyglutamine neurodegenerative disorders. This interferes with CBP-mediated transcription and causes cytotoxicity..
Pfam Number: pfam03154 Score: 130 E_value: 2e-08

Sequence:
>Contig1152
TTGGCGCTAGCCCGCTTCCTTCCCAAAATAAAAGAATCCTACATCCTCGA
GAAGTCAATAGTGGACGTCAGGAGCCAGCGGTTGGAAACAGAGACCAGGA
ATTTAGACTGGGAGGGGGTGTTAAGCGTTGTCGAGAGTCAAGTTTATACT
CCTGGCAATGACTCCACTGCCTCGGGGCTGGAAGCGCCGGTGGCCGGAGC
AGGGAAAACGGATGTGACGACTGTGGTCCGTTTCGAAAGTAGACTTGGTG
GGGCAGCACGGAACACGCAGAGTGATGGAATGACAGGGGAGGGAGTGAAG
GATGGCTGGTTCTTGGGTTGGACAACGAGCTCGGTGCAGGGGTCTATTGA
GCTTGTGGGTGTACGGAGAATGAGGGAGGGGTTCGGGAGGAGGAGGGAGG
GGATGAAGGTTGTGCTTGAGCAGTTGCGTGAACGTGGGTTTGTCGGGGTT
ATTAATGAGCAACGGCAGGGGGGTTGGGAACGTTGGAAGAAAGTGTGGCG
AGGGGAGGGTGTTGAAAGGATGGATGATTGATCAATCTTGATTTTTGGCT
TGATTCATCATCGTGATCGCTGGTGGGGAGGTAGGTTGTGGACAACTTGT
AGGGCTTGGTGGGATCGTTCCTGGGTTTACTACCATGTTCTTTCCTTCTT
TTGTGGGAGGTGAATTCATCGGTGCTTTGCTTGTTTGTTTTATTTTTATT
CACCTCCCAGTCACCGATGCCTAAGCAGTGATTCGTTTCGGTGAAACCTT
ACCCGTGAGAGGGACAAGCTTTGCACTATCTTCTTTTGTGTATTCTTTGG
GATGTATTATATATATGTGTGGGTGGGTAGGGGTCTCTTTGTGGGGTTTA
GCATTATTACTGGGGAAAACAAAACCAAATGGTCTCTCCGCTCTTGAATT
GATTGGCTTTTTCTTAC

Sequences in the Contig:

SY0AAA18YM01RM1 SY0AAA43YD04FM1 SY0AAB36YB06FM1
SY0AAC21YM21RM1 SY0AAD36YH19FM1