Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1151
Length(NT) : 1085
Best Gene Model Blast : Link to GSTUMT00001507001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1151
TTGGGGGACAACTTTGTACAAAAAAGTTGGAAATCCCCATAGGTCGTACA
AACACGAAGTCACGCCTCTTCAGGAAATAAACCGGGGAAATCCTGCTGGA
ACACCCAACCAGAGCTGCCTGTGCTACCGGTATTAAAATAAAATGGGAAA
AAAGGCCATCCATCACCCCTGGTATTTATTATCCCGATGACAGATTTTTA
AAAACCAGAGACCGTTCGTCGGAGAAGGTTTTTCCATTCTTCACTCATCT
CCCCGTCTTCAAAATAATTCGCAGCAGGTGTCGACCCTCACTTGGCTGGC
AACACCACGATAAACCCAGACGAAACCTATTATCATACATACCCCACCAC
TACTAGAGGATCTCGCATCCGCCACACCTCATCCCCCGTAATCCGCAAAC
GACGCAAGCGCCAACGAAACGAGACGGGATGTGCATGATAAAGGTCCGCC
CAGAGATTGAGGAAGAAGTAGTGGTGCCGGCGAGGCCTGTGGGCCACCAC
CGTCGGACGGGAAGTCGCGATAGCCGAATCCAGGAAACGACCGTAGTTGA
AACGATCAAAGCCCCACCGCCACCACCCTCAACCCTCTCCCTCAGCAACA
ACCCCGGAACTACTACGATAATCCAAGCTCCCGAGCCACCAGCGTCGATA
ATTGGCAGCGCTGCCGACAGCGAAATGGTCCGGCATCATCACTACCCTTA
TGACTCGCCGAGAGCTAGCGTCGTGAGTGCCCGAAGTCGGGACTACTACG
TCGACTCGAGTGCGTATGCTGCACGATCGCCGAGGAGCTCGTATCGGTAC
ATTGACGCGCGTGGATCTGGGAGGGTGGATGGGGTCGGCGGCGTTGGTGG
AAGCGGAAGGAAGGAAATGGATTACGTGCGGGGGGATAGGTATGGTTATA
ATAATTACCATGGGAGGAGGAGTGGTAGCATGAATTACGTCAACCCGAGG
CATTCTACGGCTTCGCATAGGTCTGCGCGGTCCATGAGGGAGAAGGTGGT
TGTTGTTGATGAGTATGGGAGGGAGAAGTTTTATGGAACCGTGTGAGGGA
GTGGAGGAGCGGGGCTATCCCATGATACCCTTTTA

Sequences in the Contig:

SY0AAA26YO21FM1 SY0AAA43YC23FM1 SY0AAC54YL01FM1
SY0AAC55YE08FM3