Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1150
Length(NT) : 1788
Best Gene Model Blast : Link to GSTUMT00005638001 E-value : 0.0
Numbers of ESTs : 52

Blast Results:

Nr Definition: 6-phosphogluconate dehydrogenase
Accession: emb|CAD80254.1| Score: 2048 E_value: 0.0
KEGG Definition: hypothetical protein
Accession: ang:An11g02040 Score: 2040 E_value: 0.0
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG2653 Score: 2071 E_value: 0.0
PFAM Definition: 6PGD, 6-phosphogluconate dehydrogenase, C-terminal domain. This family represents the C-terminal all-alpha domain of 6-phosphogluconate dehydrogenase. The domain contains two structural repeats of 5 helices each..
Pfam Number: pfam00393 Score: 1275 E_value: 1e-141
Swissprot: P38720|6PGD1_YEAST
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion
GO:0004616 = Molecular function: phosphogluconate dehydrogenase (decarboxylating) activity
GO:0005515 = Molecular function: protein binding
GO:0009051 = Biological process: pentose-phosphate shunt, oxidative branch
GO:0006979 = Biological process: response to oxidative stress

Sequence:
>Contig1150
TTGGTCCCTATCCCCCCTCCCTCCAAGAGAGAGCCCGAAGCAATTGGGAA
TATGACGCCGAAACCTCACTTATCCGCCCAGTTCCGCATCTCTTAGGGCC
ATAAAATAAACCCCACCACCACCATCGTCGTCAGCCCCCTCCCCCCTCTC
TCAATCACTTTTAATCTTTCCTCCCTCTTCCCACCCCTCTCTTCCGCTCT
ACATACTCCCTCATCTCCTCTCATCTCGTTCATTCAATCCCATTGAAGCA
CATAAGAAGGTGTCATGTCTGAGACTAAAGCAATCGCTGATTTCGGCCTT
ATTGGTCTTGCTGTTATGGGTCAGAACTTGATCCTCAACATTGCAGACCA
TGGCTTTACTGTTGCTGCTTTCAATAGAACCGTATCGAAGGTCGACCACT
TCTTGGAGAATGAGGCCAAGGGAAAATCCATCGTTGGTGCTCACTCCATT
CAGGACTTGTGCGACAAGTTGAAGAGTCCTCGTAGAATAATGTTGCTGGT
TAAGGCTGGCCCTGCTGTCGACGACTTCATTGCTGCTCTCTTGCCCTTCC
TTTCAGCCGGCGATATTATCATTGATGGTGGTAACTCTCACTTCCCCGAC
AGCAACCGCCGCGCCAAGTATCTCGCCGAGAAGCAGATCCGTTTCGTCGG
TGCTGGTGTGTCCGGTGGTGAAGAGGGAGCCCGATATGGCCCTTCCATCA
TGCCTGGTGGTAATGAGGAGGCATGGCCATACATTAAGGATATTTTCCAA
AGCATTTCCGCCAAGTCCGATGGCGAGCCATGCTGCGATTGGGTTGGTGA
CGAGGGAGCTGGCCACTTCGTTAAGATGGTTCACAACGGTATCGAGTATG
GTGACATGCAGCTGATATGCGAGGCTTACGATATCATGAAGCGTGGGCTC
AGAATGACAAACTCTGAGATTGGTGATGTTTTCACCAACTGGAACACTGG
CGTCCTTGATTCATTCCTCATCGAGATCACTCGCGATATCATGAAGTACA
ATGATCCTGCCGATGGGACTCCTCTCGTGGAGAAGATTCTCGACAGCGCC
GGACAAAAGGGTACCGGAAAATGGACTGCTATCAATGCTCTTGACTTGGG
CATGCCCGTCACTTTGATTGGTGAATCCGTTTTCGCCAGATGCCTCTCCT
CTATCAAGGACGAGAGAGGCCGTGCTGCCCAGGTCCTCGAGGGCCCCGAA
ATCCCAGCTTTCACTGGTGACAGGGAAGCTGCCATAGCCGATCTCGAACA
GGCGCTTTACGCTAGCAAGATCATCTCCTACGCCCAGGGCTTTATGCTTA
TTCGTGAGGCTGCTAAAGAGTACAACTGGAAATTGAACAACCCTGCCATT
GCTCTTATGTGGCGTGGTGGATGTATTATTCGCTCCGTCTTCCTTGCAGA
TATCACCAAGGCGTACCGTGCTAAGCCAGATCTCGAGAACCTGCTTTTTG
ATGACTTTTTCAAGGCAGCTATTCACCAGGCTCAGCCCGGTTGGAGGAGA
GCCATCATCCGGGGGATCGAATTTGGAATCCCCACACCTTGCTTCTCTAC
TGCCCTGAGCTTCTACGACGGATATAGGACTAAGGATCTTCCCGCCAACC
TCTTACAGGCACAGAGAGATTATTTCGGCGCCCACACCTTCCGCGTCAAG
CCCGAGCACCAGAGTGAGACCCTCCCTGAAGGAAAGGATATTCACATCAA
CTGGACCGGGAGGGGAGGAAACGTTAGTGCCTCGACTTATCTTGCTTAAA
TTAATGACCAAACAATTGAATTCGTCTTTTTTATTCCT

Sequences in the Contig:

SY0AAA14YK04FM1 SY0AAA20YL15RM1 SY0AAA23YG06RM1
SY0AAA25YM16FM1 SY0AAA25YM16RM1 SY0AAA26YF09FM1
SY0AAA28YE09FM1 SY0AAA29YM12FM1 SY0AAA30YI21FM1
SY0AAA35YG19FM1 SY0AAA35YH04FM1 SY0AAA39YO14FM1
SY0AAA40YG23FM1 SY0AAA43YC22FM1 SY0AAA43YM17FM1
SY0AAA44YC22FM1 SY0AAA44YH12FM1 SY0AAA47YI09FM1
SY0AAA4YP09FM1 SY0AAA55YK08FM1 SY0AAA61YG02FM1
SY0AAA62YE06FM1 SY0AAA63YC03FM1 SY0AAA9YK23FM1
SY0AAB11YC04FM1 SY0AAB11YO03FM1 SY0AAB12YO21FM1
SY0AAB12YP03FM1 SY0AAB15YD09FM1 SY0AAB20YA15FM1
SY0AAB20YD01FM1 SY0AAB20YM24FM1 SY0AAB24YH09FM1
SY0AAB28YN02FM1 SY0AAB2YJ05FM1 SY0AAB33YO16FM1
SY0AAB37YA21FM1 SY0AAB43YE21FM1 SY0AAB45YI18FM1
SY0AAB45YO03FM1 SY0AAB47YI07FM1 SY0AAB50YI22FM1
SY0AAB55YE04FM1 SY0AAB55YF20FM1 SY0AAB56YG09FM1
SY0AAB57YI23FM1 SY0AAB58YA06FM1 SY0AAB7YO15FM1
SY0AAB9YH08FM1 SY0AAB9YN15FM1 SY0AAC1YK15FM1
SY0AAC32YD22FM1