Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig115
Length(NT) : 921
Best Gene Model Blast : Link to GSTUMT00000792001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein CHGG_04164
Accession: ref|XP_001223378.1| Score: 211 E_value: 4e-15
KEGG Definition: hypothetical protein
Accession: fgr:FG05273.1 Score: 201 E_value: 3e-14
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig115
TTGGGGAAGCGGTTTGGCTTAACTCATACCTCCTCCACCCGTGATCCGAT
TAGGGGAGAACAGCATGGTGATCCACCAAAGGGTGCCTCTGTCTGGAGAA
CTTTGAGTAAAAATTCCCGCAGAGAAGAACTGCAGAAGGGCCATATCTCG
AGGTCGAAATCGACAGACTATGACACCAGAACATACCACTTTCCAAAGAG
GCCGACACCTCAAGACCGCCCAACAGCATTTTCCACTTTTACGCCCCTTC
CACCTTCACCATCACCGCCAATGCGTCCACTTTCTGCCACCTCCGGGCCT
ACCCATCTTTCCAATGGCAAGCCTCTGCCGTCCGAACCCCAGGTCCGAAA
GAAGCGAAGAAGCTCCCTGAGCGATTTGACGACCCATCGTGACTACCAGC
AGATTTTGCCGGCCCGAGTAAGCCCTGATCTTGAGAAGATGACAACCCCG
ACAAAGCCCGGCATTAGCGGGCTCAAAGACATCGTGAACCACAGGGCAGA
AAGCCCAAGTCCTTCCCAACTACCGAAACCAATCGGGGGAGGGACTCTGA
GCCGAAAAATGAGTAAAGACAGAAGCGAGATACCCGTTAGGAAATCGCTT
GGCATGTCTGGCTCCCCCGGCCCTCAAAGGTTAAAGATGCAAAGCACCCA
GAAACTGAGAGAGCGCCTTCAAAACGAGAAGCAGGCGATTACAATGGTTG
ACCAGAGCCTTCAGCGCGAAATTGATAAAATCGGTGAAGAGCTAAGTCTC
GCGACCAGGGTTTCTTCTCGTGGAGCCAAGGAACTCACGAGTCGCCTTGA
ACAGGTGGAAGCTCGCCTTCCCCAGATTAATGAGCTCAATGCCAAGTACG
AGGCACTCAAGAAAACCTCTGATGCGGCGTTAGCTGAGAAGGATAGAGAA
TTAGAGGTCTTAGACAAGAAC

Sequences in the Contig:

SY0AAA14YE18FM1 SY0AAB55YD18FM1 SY0AAC26YD01FM1
SY0AAC61YO02FM1 SY0AAD30YC14FM1