Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1149
Length(NT) : 1936
Best Gene Model Blast : Link to GSTUMT00009544001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein BC1G_06998
Accession: ref|XP_001554410.1| Score: 814 E_value: 1e-84
KEGG Definition: ankyrin repeat
Accession: aor:AO090113000090 Score: 742 E_value: 1e-76
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q00808|HETE1_PODAN

Sequence:
>Contig1149
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACAAAG
TTGTCCCCCGGGTTCGTGAGCCGACAGAGGGAACGTGCACTTGGGTTACG
GAACACCCAAAGTACAAGGACTGGTCGGAGAAGAAGAAATCAGGTCTCCT
CTGGCTATCGGCAGACCCAGGTTGCGGGAAATCGGTCACCGCTTCGTTCC
TCATCACGCACCTAAAGACACAAACGGATGCCATCGTTTGCTATTTCTTT
TTCAAGGACGACAGTGATGAACAGAGGAGCCCAACATTTGCTCTATGCGC
CCTGCTGCACCAGCTCTTTGTACAGAGGAATTCCCTCTCTAGATATGCCG
AGCAAGCGTTTAAGGATAAAGGAAAGAGGTTCACGGAGGAGGTGGACACA
TTGTGGAATATTTTGGTTAGGGCGGTAGCTGAGGGGGGGTGCGGCAATGT
GATCTGTGTGGTGGACGCCCTAGACGAGTGCGAGGAAAGGACTCTAACCC
CGCTTATCCGCCACATCACCCGTCTCCCAGAATCACAGACTTTCAGTGTG
CCTTTGAAATTTCTTGTTACGAGTCGTCAGTACCATAGAATCGAGGTAGA
ACTTAGCTCACCCCAAACGACGATTCGCCTGAGAGGGGAGGAAGAGCTCG
AATCTATTGCTTCTGATGTTACTCGTGTCATAGACGAGGGCATTAAGAGC
CTAGAGTCATACTGGGGACTGCCTGGGGGGCTCGGATATTTGCGAAATCT
CTTAGAAACTTCGGCCGATCGGACATTCCTGTGGGTTTCTCTGATTCTCG
AGATTTTGAAGAATAGTGAGGATGGCTCACCGGAAGAGCTTACTACAATT
GCCTCCACTGCGCCGCGCGATCTAGCAGACTTGTACACCAAGATCCTCGA
CAAATGCAGGTACCCCGACAAAGCGCGACTAATCCTGAATATAGTTGTTG
CCGCTGCAAGGCCTCTCACACTTCGAGAAATGAACATCGCATTCAGAATC
AGGCCGGAGCACAGCTCAGTTGAGGACCTCGGTGATCTTGGTAGCAGAAT
CAAAAGGACAGTGAAAAATTTGTGTGGGCTTTTCGTGAGAGTTATTGATT
CGAAGTTCTACCTTGTTCACCAAACCGCGAGGGAGTTCCTGATTCGCGAA
TCATCGGCTGGCCGGGGGAACTGGCAGCATACACTGTATCTCAAGGACTC
TAATTTCATTATGGCTAACATTTGTTTCTCCTATCTTTCTCTAAAGGAGT
TTGAAAACGACCCTTTGTCCCAAGATACTTACGGCATGAATTGGTGGCTT
AGGGATCGCGAGGTTGATAACTATCGGGAGAAACATGCCTTTCTTCGCTA
CGCGGCGAGTCACTGGGCGGACCACTTTCGCGATTCGGAGGATCGGCAGA
TGGAGTTATTCAAGTTTACACGACAGATTTGTGAAGCTGGGTCTAATCGC
TCCCAAACATGGTTTAAGGTTTACTGGGTTAACTCTCGGCTGCGGTATGA
ATGCCCCACAGATTTTACACATTTGATGATAGCATCGTGGTTGGGGCAAG
GGATGGTAGTGGAGCGACTACTGGAGGAAGGGGGAGATATCGATACCCGA
TCGGAGGTATATGGCACCGCATTGAATGTGGCCGCGGTCCGGTGCAACCT
GGATATTACCAGAACGCTGCTGCAAAGGAATGTCAAAGCATACCTCAAAA
ATAAGGAGTATAACATCTTTCAAACGAAGAAACTGTAGAGAAGTGAGCTT
AACTCGTCGGAAAGGTCGACAGAAACATCGCAATCGACAATACAACTTGC
TGCTATTAGATTTCTCGCAACACAGAAAGTGAGTAATATCGCCCAATTAC
TACTAACGCTCCTCCGCACAGGATATTTAGTAACCTTCTTATAGCAATTT
TGCATTCCAGATACGCCCGATCCCCATGTATCTAGG

Sequences in the Contig:

SY0AAA30YM21FM1 SY0AAA39YM08FM1 SY0AAA43YC20FM1
SY0AAA53YK18FM1 SY0AAB20YK24FM1 SY0AAB7YM22FM1