Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1148
Length(NT) : 1204
Best Gene Model Blast : Link to GSTUMT00010480001 E-value : 1e-171
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein FG09466.1
Accession: ref|XP_389642.1| Score: 228 E_value: 6e-17
KEGG Definition: hypothetical protein
Accession: ncr:NCU03981.1 Score: 269 E_value: 5e-22
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1148
TTGGATAAAGGATGTCGCGACACAAGAATATTCGAAATCTTGACCCATAC
GCAGAACTCGATGACTTCGATGGAGGGGGGTCTAATGATATTAGCGCATC
TGATGAAAGACAATTACAGGAGGGCCTGGTCCAAGTTCGGGGAGCCCTGG
AACGCGCTAGAATTTCTGTCACAGATAAGGAGATTGAAGAATCGCTATGG
TACTACTACTTCGACGTCAGCAAGACTATTAATTACATTTTGAGCCATCA
TGCGCCAGCCAAGAAGTCAAAAAAGAAGGCCCAATCACAGTTTACGCAGA
AAGCTCAAAAAGGTACTTCAGAAGTTTTGCCTTCGTCATCTTCATATACG
GCACATGAGCACTTTTGTGCATCGCCTAAAACTAATCTCCCAGGCAACTT
CTCAGGGATTGGTCAAGGCCATGGCTTGGAAAAAAGGACGGCGACAGAGC
TTGGTATTTTTCGGGATTGCCCGTGGGGAGATATACCTGAACACCGACGA
GGAGAGATAATTGCTGAGAGTATTTATCCCCGGGGAGGGTTACTCGGCGG
ATCGGGCAAGATGTCCAAACTGGCGGCATTAGCTAAGGCGAGGAATGAGA
AAACGGCTGTGGAAAAGAAACAAGACGGAGAAGAGAAGACATCAGTGTCT
CTGTTGGCACGACTGGCACCAAAGACACCGGCCCGAAAACCTATGCCTAT
GCCCAAGCCTCTGCCTCCCCCAACAACACAAGAGAGTAAACAAGAGACAA
AGCAAAAGACCAAACAAATTATAATTCCGAATCCGCAGTCCGAAGCAGAC
CCGGAGAATGCCGCCACAGCCTCTAGCCAAGGCCTTGGCCACCCAGAAGA
GCCCCAGACATTTCCTCCAATTCTTAATGACAAGTCTATTTATATGCCCC
AATTCACAAGCCTTCTCGGCTCCCCATCCAGTTTTGCACTGTCGTTTTTC
GGGGAGAGGATCTCGACTATTAAGATGAACCCTACTAACCAGGAGACATT
CGCTATTTCAGGTGCCCCAACGGTGGCACAAGCCAAAGCTTTCTCGGAGC
CTAGCCCTGATGATATAGTGATGGCCGCCCAGAGTAGTAGTAAAGGTTTG
AATAATGCAAAAAAGAAGACAGATAAACCCGCCGAGAAGATAGAGGCCGC
CGTCCAGGCGATGGCCATCGACAACACGCCTGTTAAGGCCAGAAAGAAGA
TTGA

Sequences in the Contig:

SY0AAA43YC19FM1 SY0AAC47YH05FM1