Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1146
Length(NT) : 1325
Best Gene Model Blast : Link to GSTUMT00006215001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG1830 Score: 123 E_value: 2e-07
PFAM Definition: DUF1421, Protein of unknown function (DUF1421). This family represents a conserved region approximately 350 residues long within a number of plant proteins of unknown function..
Pfam Number: pfam07223 Score: 120 E_value: 5e-07

Sequence:
>Contig1146
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGATTGCATCGCCAGTTAG
TGAGCGTTCGGAGAGCGGTGTTCATGCACTCGTGCCGTCTCCGGTGCACC
GGGGGGAGGAGGAGTCGGGAGTGTTTAGGAAGCCGAGGCTGGATAGGAAG
ACCAGCGGCATCCCCAGCTTCGACAGTCTCTTCGAGACGAAATGGGATTT
TGATATGCTCATTCGAAATGTCACTCATGCTTCGAGCAAAACTAAAAAAG
GTTGGGTTTTAGACGAACCCAAGACTTCTATTAGGCAATCTAAAGATATC
CCCATGGCTTCCTCCTCTTCGTCTTCGCGAGTCAGCGAGAGCTCCATCTT
CGGGAGCATGCACGGATCGAAGGCGACCTTTGGGAGTTACTTGAAGTACC
TCCAGAGTCATCGCAGGAGTTATTCTTTCGGAATGCTCCTCTTCGGATGT
CTAAGCTTGGTCATGTTGCAGAATAGATTCCTAATGGCAGGAATAATGAC
GGAGACACCTTTGGCGCAGGCCAGGTATGCTTACGAGGGGTATAATGCTT
CGCAATATGCCACTATAGACTTCCCGGGACTCCTCTCGACCGAGACAGCG
TTGGAGAAGAGCCTTGCAAGCGTCGCTGCAGCACCCGCTCTTGCCAGATT
GCTAAAACAGAGTGAGATAACTGTCAGCGATCTGAGCACCGTAGTCCAAC
ACAGCGACCTAGACTGCAAGCACACCCTCTCGGACCTCCTCCTCAAATTC
GCGACTCAAGCGGGAGACGTGGCAGGCTTACTCCAGGCCTTTGAAAGCAC
CGTCAGTCGAGCACTCACTCAACTCGACTCCGCCAACGCCCAAACCCTCC
AGCACCTCAACCACCACCTCCCCCCACCACTTCCATTCTACAAATCCCTC
CTGAGGAAAAACCCCCACCACTACTACCACCTCCTGCCCTCACAAACGCA
ACACCTCTCAACCGCCCACGAAATACTGGCGCACCACATCAACAACACGC
TCTCAGCCCTCGCCCAGGAAACCGGCGCAATCCTGCGCTCCCTGAGGACA
CTCTCCCACCAACACGCGCCAATCTACGCATCCATAGTCCGGGAATTCAC
CGCGATCGAGCGCGCCCAGACTACCCTGTGGACGCGCGCTCGCGGAGTGG
ACTACAGCGAGAGTAAGGAGTTACTCGCGCTTGTGGGCACGTATGAAGAG
AAGGCGCGTGGGTACGTCGAGAGGGTCGGCATGGAGTACGTCGCGCTGCG
TGGGGAATTGGTGGGTTTACGAGAGGGGTTGAAGGAGGCGGGACGAGTGA
GCGGTGGTGAACTTGTTCCATTCGA

Sequences in the Contig:

SY0AAA43YC02FM1 SY0AAB20YM10FM1