Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1145
Length(NT) : 899
Best Gene Model Blast : Link to GSTUMT00005356001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE55022.1| Score: 652 E_value: 2e-66
KEGG Definition: Ca2+ transporting ATPase
Accession: aor:AO090009000591 Score: 652 E_value: 1e-66
KOG Definition:
Classification: [Inorganic ion transport and metabolism].
Kog Number: KOG0202 Score: 709 E_value: 1e-75
PFAM Definition: E1-E2_ATPase, E1-E2 ATPase..
Pfam Number: pfam00122 Score: 393 E_value: 6e-39
Swissprot: P22189|ATC3_SCHPO
Gene Ontology:
GO:0005388 = Molecular function: calcium-transporting ATPase activity
GO:0006816 = Biological process: calcium ion transport
GO:0006874 = Biological process: cellular calcium ion homeostasis

Sequence:
>Contig1145
TTGGGGTGGGGGGAACCTGGGCCTGTGGGTTTATATGATATAGTCTACCA
TGGGGGTAGGCGAGCTGCTTTGGAGCCAGTTCTGGGCTTGCTTATTCTGA
ACCTTTTCATGTATAAATACGCTTCCGTCCCCCCCGCCTCTCTCTTCTTT
CCTCTCTTTCCACCACCAACCCTACAAACCTTGTAGACTACCAGCTATGG
CCCCAAAGAAATCTGGCCCTCGGGGGCCCTCATTCTCCCGGCCACCTTAC
CAGCTCTCCGCTGATGAGCTTGCCCAAGAGCTCGGGACAAACCTTGAAAC
AGGGCTTTCCCCCTCCCAGGCCAAACAGGGCCTCGACCAGTATGGCGAAA
ATAAGCTTGAAGGGGGCGAAGGAATTCCAGTGTGGAAGGTATTAATCAAA
CAGATCAGCAATGCCATGATTCTGGTACTTATCATTGCCATGGCTCTGTC
CTATGGAGTCAAAGATTGGATTGAGGGTGGCGTTATTACTGCCGTTATCT
TTCTGAATGTCACCATCGGCTTTTTCCAGGAATACAGAGCCGAGAAAACT
ATGGATTCTCTACGAAGTCTCTCTAGTCCCACCGCCGCGGTTTTGCGAGA
TGGAAACCTCGATCATGTTGCTAGTATTACGGTCGTGCCTGGTGATATTG
TTGAGCTTAAGACTGGAGACGTTGTCCCCGCCGATTTGAGACTTTTCGAA
GCGATGAATTTTGAGACAGACGAAGCTCTCCTCACGGGAGAATCTCTTCC
TGTCCCCAAGGAACCCGAACCCCCAATTGAAGGTGAGGTTGGTGTTGGCG
ATCGAACAAACATGGCTTTCTCTTCGTCCACTGTTGCAAAAGGCCGCGCC
CGTGGCATCGTGACTGGTACTGGAATGGCTACCGAAATTGGTGCTATTG

Sequences in the Contig:

SY0AAA43YB21FM1 SY0AAC14YO08FM1 SY0AAC33YP04FM1