Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1144
Length(NT) : 716
Best Gene Model Blast : Link to GSTUMT00004799001 E-value : 4e-23
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1144
TTGGCCCCTCATACAACCATCCTATTTCTCTATGAAACGCCACCGCTTCT
GTCGTCTGCACAATAACAATTCAGAAAACCCCCCGGGAGTAGGTAATCCA
CGAGCATAATCCCAAGCTTGTCAGTTACCCCGGACACCGTATAAGCCCTC
ACGGAAAAAGGCACCGGCTCTTTGTGACAGGATCTCGAATAGCGGATTAG
AAATGTGCTGATTGTCTCGCAGCCAGGGCTAAAGGCGAGAGGCCCCTGGG
GAGCTTGACATTCAGATGAAGCCGATAATAATGACGAGTGATTGCTTGTG
ATTTTCTTGTGAAACTACATACGTGCCTCGGAGGCTGGAGGCGACAGGAT
GAGATGGGACTCAGGTACAATTACCGGGGGCTGAGCCAGTGCAGACGGGC
CCCTTCTGTTCATTCGTGAAGATATACTGGGTGCTATTGTCCTAGCGGAG
TTGAGGAGAAGCGCCAGATGTCAGATTTGAAGTTTAAACTCCGAGAAGTC
TTTTTTTTCCTGCTCCAGTTGGCCTACCATATCAAGTTACCGGTCCAAGG
ACTGTAGGAAGAAATGAATATAAGTGCCCTGAAAGACAGTAAAGATTTTC
CTACCCCTCATACAACCATCCCCCATCCCCCCTCGAGTATCAACCAAGAT
AGTAAATAGAAAATGTCAATCTCACCTGTTCTCGAACACCCTTCTCTTGG
AAGCCGCCTCCGCGGG

Sequences in the Contig:

SY0AAA43YB04FM1 SY0AAB48YJ19FM1