Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1143
Length(NT) : 3107
Best Gene Model Blast : Link to GSTUMT00011849001 E-value : 0.0
Numbers of ESTs : 21

Blast Results:

Nr Definition: chitin synthase 1
Accession: ref|XP_001593534.1| Score: 2632 E_value: 0.0
KEGG Definition: hypothetical protein
Accession: ang:An07g05570 Score: 2554 E_value: 0.0
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis].
Kog Number: KOG2571 Score: 1331 E_value: 1e-147
PFAM Definition: Chitin_synth_1, Chitin synthase. This region is found commonly in chitin synthases classes I, II and III. Chitin a linear homopolymer of GlcNAc residues, it is an important component of the cell wall of fungi and is synthesised on the cytoplasmic surface of the cell membrane by membrane bound chitin synthases..
Pfam Number: pfam01644 Score: 743 E_value: 7e-79
Swissprot: P30588|CHS3_NEUCR
Gene Ontology:
GO:0005886 = Cellular component: plasma membrane

Sequence:
>Contig1143
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCAGTCAGTCAGTCAGTCAG
TCAGTCAATCAGTCGATCAGAGCGGGGCTCCAGACGGAGAGCTGACAGAC
GTCATCCTTTTTATGGTACAGTGTGGGTAGAGTGGTTTACACATTCCCGG
AGAGCTTTTCAGGTTCGATTTCTTTTTAGTGCTACCGGTGCTACTTCTTG
GTTGGGGATAAACATTTGGATTCATAGAGGGAAAGTGTGATAATTCCCCT
CCAAAGTGTCCTGACCCTTCCCCGTCTCGTTCGCTGGGGGCGCCGCTGTC
GCGCCTAAGCACCCATTACGAGTACAGTACCGTACTATCATACACACCTA
CACCTTTCCTAGCTTTAATTTTAACTGTATGATACCGTACCCGGCTGCGA
CGCCCATCCACTTTTGAATTTGCCTTTGTCCGGAACCGGCCATCCAATAA
CTTAGAAATTGGATAAAAATAAGATTAAAAAATTTATACAAAACCGAGAG
CCATGGCGGGCCGGGATAATAACGACGCTTACAGCCGCCTCGACTTTGAC
GGTCCTATTCACCACCACGACTCCGACGACGACGAGACAGGACCTCTCGC
GCAACAACAACACCGACAGTCGCACATACCAGTAGCTGCTACATCACCCG
TAATGGATCCTCGATATCGGACGCCCTCGCCCGCTCACGCACTGGCTGGT
TACCAGCTCGAGGAAGCTCCATATAGGCCTCAACGACAGAATACTGGTGG
ATATCCTGCTGGCTCTGCTCAGATGCCCGGCGATACCTTGGCGTATCAAC
CAAGTTATTCCGTCACGAACCTTGAACATTCGTACAACACAGCCCCACCT
GGCCCTCCATCCCGAACTGGCCATCGCCAATCTATAAATTATTCGCAAGG
TCTTTATCCGGAGGGTCTCCGTGACAATTACTCCGTCGACCCCTATGAAC
CCCATCCGCCCGATCATACCTATCCCCTGACGCAATACACCACCCATCAC
GACGATTACCACGATGATGATGACCGACGACCTATTTTAGAGCCAGATTC
CCCTCATAGAACTCCTGGCGATGCTTCTTATTTTCCGCGAAACATCCCAT
CGCCCGTCTCGTCTGCCCCAACCCCGGGACCGGGCTTGAGAAGATGGAAG
ACGGTTAAGAAGGTGGAGCTTTTTAGAGGGAATTTGGTCCTGGATTGTCC
GGTACCTAATAAACTACTTGGTGTGCTCCCGTCGAAAGCTGAGCGTGAAT
TTACGCATATGAGATACTCGGCTGCTACTTGTGACCCCTCCGAGTTTGTC
CGGGAGAAATTCACATTGCGACAGCAGCTTTTCCAGAAACCTCGTCATAC
GGAGCTCTTTATTGTAGTCACTATGTACAACGAGGACGAAATCCTGTTCG
CTAGAACAATGGCTGGTGTCTTTAAGAACATCCACTACTTGTGTTCTAGG
AATCGCTCGCAGACGTGGGGTACGGATGCTTGGAAAAAGGTGGTTGTTTG
TGTCGTTAGTGATGGCCGTGGTAAAATTAATCCTAGGACGCGGAGTGTTC
TGGCGGGTATGGGATGTTACCAGGAGGGCATCGCTAAACAGAAGGTTAAC
GACAAGGAAGTTACGGCTCATATCTACGAGTACACCACTCAAGTTGGTAT
CGATCTTAAAGGAGATCTGGTAAAGCTTACTCCAAACGGGAAGCAAGGGC
CAGTTCAAATGCTCTTTTGCTTAAAAGAACGAAATCAGAAAAAGATCAAC
TCGCATCGTTGGTTTTTCCAAGCTTTCGGCCAAGTCCTTGACCCGAATGT
TTGTGTTCTCATTGATGCGGGAACTAAACCTGGCGGGTCGAGTATCTATC
ACCTATGGAAGGCCTTCGACATCAATCCCCAGTGCGCAGGTGCTTGTGGT
GAAATCAAGGCCATGTTGGGACCGGGAGGCAAATATTTGCTCAATCCACT
TGTTGCGACTCAAAACTTCGAGTACAAGATGTCCAATATTCTCGACAAAC
CATTGGAGAGTGTGTTTGGGTTTATCAGTGTGCTCCCCGGTGCTTTCTCC
GCCTATAGATATACGGCGCTACAGAACGACGCACAGGATGAAGGTCCTTT
GGAGAAATACTTTAAGGGAGAGAAGATGCATGGTGGTGACGCTGGTATCT
TCACTGCCAATATGTATCTTGCTGAGGACCGTATTCTCTGTTTTGAGCTT
GTGGCTAAGCGGAAGGCGAACTGGGTCTTGCAGTACGTCAAATCGTCAAG
TGCCGAGACGGACGTGCCGGACGAAATGTCGGAGTTGATTTTACAGCGAA
GGCGTTGGCTCAATGGTTCATTCTTCGCTGCCGTTTATGCTCTAGTGCAC
ATGTTTGATATCTGGAGAAGTGACCACTCGATGATGCGGAAATTGATGTT
CCACGTTGAGTTCTTCTACCAGACAATATCTATGTTATTCTCGTGGTTCG
CTATCGGCAACTTTTTTCTGGTTTTTAGGATTTTAACAGTCAGTTTGGCG
GACCCGGCTCTCAATTTTCCACCCGGCAATGTGCTCAGTATTGTGTTTGA
ATGGTTGTATCTTGGGACTCTCCTCACCTGTTTCGTTCTGTCACTCGGAA
ACACTCCGCAAGGAACTAAGAAGCTTTATATGACTATTGTCATCTTCTGG
GCTGTTCTCATGGTGTATCTATTGTTTGCTGCCGTCTTCATCTCCGTCAA
ATCTGTTACGAAGGAATTAGCAGATAATGGGGGTAAATTCTCGGCCAGCA
GTATCTTTCAGAACCAGTTATTTAGAGATTTGTTGATTTCGCTGTCGTCA
ACGTACTTGCTTTACTTTGTGGCTTCGTTCATGTTCTTTGAGCCATGGCA
TATGTTCACCAGTTTTGTCCAGTACCTCCTCCTCTCACCTTCTTACATCA
ATGTCCTGAACGTCTATGCCTTCTGCAACACCCACGATATCTCCTGGGGT
ACCAAAGGGCCTGACGTGCCCCCACCCATCAAAAACGGAGCGGTAAAAAC
AGTTGACGGAAAAGCCGACATGAATGTCCCAACAGACGACAAAGATCTTG
ACGAGCAGTACGAAGCTGAAATCAAAGTCCTCGCCGAAAAGTTTGTGCCC
GAGCCGG

Sequences in the Contig:

SY0AAA15YO13FM1 SY0AAA18YF05FM1 SY0AAA28YK09FM1
SY0AAA2YJ12FM1 SY0AAA34YN22FM1 SY0AAA42YP22FM1
SY0AAA44YB04FM1 SY0AAB11YC08FM1 SY0AAB39YL23FM1
SY0AAB51YH16FM1 SY0AAB52YB03FM1 SY0AAB53YN14FM1
SY0AAB54YN14FM1 SY0AAB9YO14FM1 SY0AAC10YN12FM1
SY0AAC40YJ17FM1 SY0AAC41YH07FM1 SY0AAD15YE11FM1
SY0AAD22YF07FM1 SY0AAD23YD10FM1 SY0AAD46YP12FM1