Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1142
Length(NT) : 2358
Best Gene Model Blast : Link to GSTUMT00005010001 E-value : 0.0
Numbers of ESTs : 16

Blast Results:

Nr Definition: hypothetical protein SS1G_14092
Accession: ref|XP_001584995.1| Score: 288 E_value: 1e-23
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1142
TTGGATCACCACCATCGTCATTATATTCACCCTAATCTTTCTTGGCTAAT
TAATCCTCAACGCGTATTTCCCCCTACAAGTACAGTACAGTACAACATTT
ATCTCGCAACTATCCGAAAGCTCATTCGCTACGATACGACAGCTTTGAGA
TTTTTTTTCTTCCCCCATCTCAGGTTTCAAGGCACCCAACGGATAACCCC
CAAGTCTATTACCGATCATGCCACCACAACCAGGGAGTGTCCGTTCCGAG
TCTCCTGATGACTGCCGTTTCTTACCCTGCGACTACTCTGACGGAAAGGT
CCTCTATCCGACTAATCTTGAAAAGAAGCCTCGCGCCGATGGTGCCTACG
AATATTATTCCCCTGTACCCACTGGGAGCAGTAAAGATGTCATGTGGAGA
ACCAAATGCGGTAATCATGTTTACCAACTATTCTCCAAGCAAGAGAATCC
TCAAGAATCACTTGACTATGTTTTCGCCGAGTTTCCGCGGAATTACAAGC
TCTTTGAGCATGTCAAATGTTCCGCTAAAGATGGTGTTCTTGGGAAAGAA
AGATCAGACACCTATCTATACGGACATCCATCGGGAAAGCGCTATCGATC
ACCAGCCGAGTTCTTCCCCCACATTGCGTACCTTTGCCGTTTCAGTGCAA
CTAAGAACCCCGACACCAAGGGGAAATTCTGCCAATGCTGCCTGTGTAGT
ACTGTGGGTCCGAAGACCGGGCCAGCTACCTCAACTTTCAAGGGATCCGT
TCAATTTTACCAGAAGGAAGTTAGGAGGGTAAAGACAGTTGTATGCCAGG
AGGAAAAGATTGCGGAGCAGGATTGCGGAGGATGGGTCATACGCAAAGGA
GAGATTGGATGGGTTTGGCTTCCTGTCAATGAAGAGAGAAGCTATGAGGG
GATAGATGAGAAAAATCTAGTCGACGGTCAGGGTGGCGTTTGGGCTGCAG
GGATAATTGTCGAACGCCCTGGATACACACCTTTCCTCATGCCTCCTAAC
ATAATTACTGGAACCAGGGAACAAGAAACAGACCAAGATCCAATGAGAAC
ATTTGTTAACGTGGAAAAAGACATTGTTCCGCCATGGGCTACCGACAAAG
ATTCGTACACTATCCAGCTCTGCGCTGGGAAGGGGAAGAATGGAGAGGTT
ATCAGCGACGTCAAACAGTGGTTTGTCAGGCCATGGTTGTCACGCCCTGA
GTGCGCTATCAATTACGAGGCGAATGAATCCGAACACCCCTCAGTTGTGT
CTGGTCGGGAAGTCGCAGGTACATTCTCGGTATTCGATAAGATCCCTGAT
AGCATACATTCTGTTATCGAAAAAGGGGAGACAGAGAAGGTCAGGGTGGC
GTCGTATAATGGCATTTACCTAGGTGCGGAAAAAATATGGGTTGATGAAC
CAATACGTATTAAGTGCTTTACCGAAGGGAGCATAGTTGATGGGGCAGAA
GATATGATGGTTGTCAAGTCGATTCAGACCTACACTTCACCCTCCAAAAT
CAGCCCCGGTAAATCAACAACCAGAATCGTCTTTGGAGGTCCGATTTTTA
CTGCCTTTCCTCGGAAAGGTACAGAGCCGGTTCAAGACGAAGCAAGTCTC
CAGCTTCCTCCCCGCATGCGTCGCTCATGCGGTGGCGACTGGACTATTAA
GTGGTACATTCCGGATGGATCGAACGAAAGGTCCAAAGTTATTCTCAAAG
CCGTTCTCGGGAGGTACTACGAACCCCAGGCGATTCAGGTATGGACTGGA
CGTCACGACCTCCTTTATGGAGGGGACCCGACTCTGAAAATATTTCCGGT
CGATATAAGAGGATGGGCCAATTCGAGACTCGAGGCTTTCGGATGTACTA
TCTTGAATGGCTTGGACCTCAGCGTGATTGACATTGAAGATAAAATAGAA
TCAAAAGTGGGGCCGGCTATGCTCTATCAACAGGAGGAGGAGGATACGCT
CAACCCGCTCAACCCACCTACCGATGCCTGGGAGAATTTTGAGGAGAACA
ATCAAAAGGAAGCAGATCGGGAGGGTGTGCTTATGAGCGATATGGAGGAT
ATAATGGAGGTTGACCCCCCTAGAGGCTTTGTGAGTGTCAATGTAAGGAC
TATTCCCCATAGCATTGGTCAGAAACGCGAAGGAGGTGCCTAGGTACCTC
TTTTTTTATCCACCATTATCTCGATGGAGATTGAGGGGGTAACGTTTGCG
CAGGGTTTGATCTGCAGTGGGTATTTTATGGATTGCTTTTTTCTTTTCCT
TCTTTGTGCCTATTCTAGCTTTATCAGAAGGGTGTCTACAATGATTTTTC
TTCATTCCTCATCTGTATGATACCAAGTTTCAATTCTAAAAAGTTACCAT
CGGTAGTT

Sequences in the Contig:

SY0AAA19YH20RM1 SY0AAA25YG08FM1 SY0AAA25YG08RM1
SY0AAA42YP05FM1 SY0AAA46YP12FM1 SY0AAA49YG09FM1
SY0AAA52YN17FM1 SY0AAB10YM21FM1 SY0AAB41YK18FM1
SY0AAC6YI14FM1 SY0AAD14YL02FM1 SY0AAD29YG11FM1
SY0AAD29YI04FM1 SY0AAD35YK24FM1 SY0AAD39YN05FM1
SY0AAD58YC17FM1