Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1141
Length(NT) : 1078
Best Gene Model Blast : Link to GSTUMT00011988001 E-value : 1e-150
Numbers of ESTs : 7

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1141
TTGGTTTCCCTTCTTTTTCTCTTCAGACATATAATTCCCGCCCTTCACCC
TTGACGGGGTTTGTGCTTTTTCTTCTTCCCTTCTTCCTCCTCCTCCTCCG
CTCCTTCCCCCCCCCATCAAGCGTTTTGTTTCTCTTTCTTGAAAAAAAAC
AAGGACCATCCTTCTCATTTTCTCCTTTCATCTTTCCTCTTCCTTTCCGA
TTGAGATATCGCACGCAGCTGGGTTCGTTCATCGGTCGCTTCTGGGAAGG
GGTATTCCGTCTTTTCTTACTTTCTTTACTTTTTTTTCTTCTATTCGAGT
TAGTTGATTTGCTTGACAAACAAACTCTCCCTCTCGCTACTACTGCATTT
GCCAGCTCTCGTTTCTCCTCCAGAGCTTTAAGTTATATCGGACTGTTTTC
CCCGAGTTGCTACTCCGCGATACCATCTACCGCACCCATATCTACCCTTA
ATTACAACAAACCAATTAGCAATGGCCGCCTCAACATCCTCATCCCTCTT
CACCAGAGCACTATTGTTCTTTCTCCTGTTCGTCATCCTCGCTGTCAGTG
CAAATGCACAATCCGCCAGCGAAACCGCACACCCGGTAACCCCAATCACG
AACGGCACCGCCGAGCCAACATATACTACCCCAGCGGTACCAACAGGCAC
TAGCGACCAGCCTAGTAGCGCAAACACCCTCTCTTCAACGGTGGCATTGT
TTGGAGCTTTGATTGCTGCCGCTCTGTTTTCTATATGATCAGATTTCTTG
TTTCTATGAGATGGGGTTTATCAAAGTTCGGCGTGCGTGCGAAGGAGTTG
GAGGATTCTATCATACTGGACAGCGGGAACGGTCTAGCCACGGCTGAAGG
CTAGCATTGGAAACTTTTCTTGCCCGCTCACACCAACTCACGCCCACTGC
TTGCTTATCCTATTTAATTCGGAACCTTTTATTTGATATCGCTTTTTTAA
TCCTGGGGGGGCCCTTTTTCATATACACTTTTAATCGCTTCACGCTTCTA
CCATAACAAACACCAACTCCCAATTTACCGCGCAGATTCAACCTCCTCCC
GAACCTTTAACTCGATTTTTCAATACCC

Sequences in the Contig:

SY0AAA10YG05FM1 SY0AAA42YO20FM1 SY0AAB55YI21FM1
SY0AAB55YJ07FM1 SY0AAC43YJ10FM1 SY0AAC44YC12FM1
SY0AAC5YJ02FM1