Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1140
Length(NT) : 656
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 6

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1140
TTGGCTCGCCCAACAGTTCCTTCTCTTTTTATCCCATTCAGCCGCCGCGA
GCTGGGCATTGTCCTCTTGTGTTGCATTGTGTGGTTTTCTTCCTATTTCT
CCACGACTGCTAGCACCAAGATACTTCCACGGCAGTCTTAGAAGACCGAT
CAAACTCCCCCCAATTCACCACATCCATCTATCATCTCCTCAAAACCCAT
CATTGTAAATTACCTTCCCCCTTCCCCTCGCACGGAAGGGTATCCAGCAG
AGCACTCCGTTGCATGCGTACACGCAACGCTATCACCATCAACTATCGAC
AATTGCCGCCATCCATCTACCACCACCATCACACTATCTACACCTTTTTA
CACCACATCCCACATCACCTCACCGCAAAAAAGGAATAGGATATCCCTAT
TTCTATTTCTCTCAGTTTTATTTGACCTTTTTTTCTTCCCTCGAACAACA
AAATCAAAAAACTCCTCGCGGCCGGGGGAGAAAAGTCTAATTGAATCGCC
TAATACCATCTATAATATCTACCCACCAAACTTACACACACGAAAACCCC
CCACTACCACCCGCGATAATAATAATAAAAATAGAAGGAAAAAAACAGAA
AAAAACAAGAAAAAGGTAACACACACATGAATACCACATCCTTCAAGCTC
CCCCCA

Sequences in the Contig:

SY0AAA42YO15FM1 SY0AAA5YN23FM1 SY0AAB20YL13FM1
SY0AAB42YC10FM1 SY0AAC1YJ21FM1 SY0AAC48YI02FM1