Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig114
Length(NT) : 2838
Best Gene Model Blast : Link to GSTUMT00010158001 E-value : 0.0
Numbers of ESTs : 100

Blast Results:

Nr Definition: hypothetical protein BC1G_07510
Accession: ref|XP_001553950.1| Score: 3393 E_value: 0.0
KEGG Definition: hypothetical protein
Accession: ang:An04g09170 Score: 3384 E_value: 0.0
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0730 Score: 2281 E_value: 0.0
PFAM Definition: AAA, ATPase family associated with various cellular activities (AAA). AAA family proteins often perform chaperone-like functions that assist in the assembly, operation, or disassembly of protein complexes..
Pfam Number: pfam00004 Score: 624 E_value: 4e-65
Swissprot: Q9P3A7|CDC48_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0000790 = Cellular component: nuclear chromatin
GO:0005515 = Molecular function: protein binding
GO:0006510 = Biological process: ATP-dependent proteolysis
GO:0007059 = Biological process: chromosome segregation
GO:0006950 = Biological process: response to stress
GO:0051230 = Biological process: spindle disassembly
GO:0006511 = Biological process: ubiquitin-dependent protein catabolic process

Sequence:
>Contig114
TTGGACCTCTTCTCATCATTCTTCCCCCCTTAACTCCATCTCTCTCCCAT
CCATCAGCACTGCTACCATATCCCACCTCGCTTCATCTCTCAAGCTCTAT
CTATCTGATTTGCTCCTTCATTCTTCCTACCCAAGATGGCTGATCATGAA
GAGAAAAAGAAGGTTAATCTGGCCGATGCCTCAGGCGCCACTCACAAAGA
GGCGGACGAAACCGCAACGGCAATCTTAAAGAAGAAGAAGAAGCCGAATA
GCTTGATTGTCACTGATGCCGTTAATGATGATAATAGTATCATCGCCTTG
TCTAATAATACCATGGAGACGCTTCAACTGTTTCGTGGGGATACTGTGCT
TGTCAAAGGGAAGAAGCGGAAGGACACAGTCCTTATCGTTCTGGCGGATG
ATGATCTTGATGACGGATCTGTGAGAATCAATCGTGTCGTTAGAAACAAC
CTCCGGATTAGACTTGGCGATGTCATTACCGTACACCCGTGTCCTGATAT
TAAATACGCGAAACGTATTGCCGTTCTCCCTATTGCAGACACTGTTGAAG
GATTGACTGGATCTTTGTTCGATGTCTACTTAAAGCCATACTTCCTTGAG
GCCTACCGGCCTGTACGTATGGGTGATCTGTTCACTGTTCGCGGTGGTAT
GAGACAAGTTGAGTTTAAGGTTGTGGAACTTGATCCACCAGATTATGGAA
TTGTCGCTCAAGATACGGTTATTCATTGTGAGGGCGAGCCTCTTAACCGA
GAAGACGAAGAGGGAAATCTTAATGAGGTTGGTTACGATGATATCGGTGG
GTGTCGAAAGCAAATGGCGCAAATCAGAGAGCTCGTTGAGCTGCCACTCC
GGCATCCTCAACTGTTCAAGAGCATTGGTATCAAGCCACCACGTGGTATC
CTTCTTTATGGACCTCCGGGCACCGGTAAAACACTTATGGCCCGTGCTGT
CGCCAACGAGACTGGGGCCTTTTTCTTTTTGATCAATGGTCCCGAAATCA
TGAGCAAAATGGCCGGAGAGTCGGAATCTAACTTGCGTAAGGCCTTCGAG
GAGGCAGAGAAGAATTCACCCGCAATCATTTTCATCGACGAGATCGACTC
GATTGCCCCCAAACGTGAAAAGACCAACGGCGAGGTTGAGCGGAGAGTTG
TTTCACAATTACTTACCCTGATGGACGGAATGAAGGCTCGAAGCAACATC
GTTGTCATGGCTGCTACGAATCGGCCAAACTCCATTGATCCTGCTCTTCG
TCGGTTCGGGCGATTCGATCGCGAGGTCGATATCGGTATCCCCGACCCAA
CTGGGCGTCTTGAAATTCTCCAGATTCACACGAAGAATATGAAGCTCGCC
GAGGGCGTAGATCTCGAACAAATTGCGGCAGAGACACATGGCTATGTTGG
TTCCGATGTTGCTTCCCTCTGCTCCGAGGCAGCTATGCAGCAAATCCGTG
AGAAGATGGATCTCATCGATCTTGATGAGGACACTATTGACGCCGAGGTT
CTTGACTCTCTGGGAGTTACAATGGAGAATTTCCGATTTGCCCTTGGTGT
TAGTAACCCATCTGCCCTCCGTGAGGTTGCCGTGGTTGAGGTACCTAATG
TTCGTTGGGATGACATTGGAGGGCTGGAAGAAGTCAAGCGCGAGCTCATC
GAGTCCGTGCAATACCCTGTGGAGCACCCCGAAAAGTTCCTCAAGTTTGG
AATGTCCCCATCTCGTGGTGTTCTGTTCTACGGTCCCCCTGGCACTGGTA
AGACACTGCTGGCGAAAGCGGTCGCGAATGAATGTGCTGCAAACTTCATT
TCCGTCAAGGGTCCCGAACTTCTCTCTATGTGGTTTGGTGAATCTGAAAG
CAATATTCGGGATATCTTCGATAAGGCACGCGCTGCGGCGCCTTGTGTTG
TATTCCTTGATGAGTTGGATTCAATTGCCAAGAGCCGTGGTGGATCTATG
GGTGATGCCGGTGGAGCCAGCGACAGAGTGGTGAATATGTTGTTGACTGA
GTTGGATGGTATGGGTGTTAAGAAAAATGTTTTTGTCATCGGAGCTACCA
ATCGTCCCGAACAGTTGGATGCTGCACTTTGTCGCCCAGGTCGTCTAGAC
ACTTTGGTCTATGTACCTTTGCCGAATGAGGCTTCCAGGGCCGATATTCT
TAGGGCTCAACTCAGGAACACTCCTTGTGCCCCTGATATTGACCTTAAAT
ACATTGCCTCTAGAACTCACGGCTTCTCCGGTGCTGATTTGGGCTTTATT
ACACAACGCGCTGTCAAATTGGCAATAAAACAAGCTATCTCTGCTGAAAT
TGAGGCACAAAAAGAGAGGGCCGAGAGAGGTGAGGGTGCCGATACCGAGA
TGGTAGAAGCCGAAGGGGATGACCCAGTCCCAGAGCTCACCAAGGCTCAT
TTCGAAGAGGCCATGGCAGTTGCCAGACGTTCAGTCTCTGAGGTCGAGAT
TAGGCGTTATGAGGCCTTTGCTCAGAGCATGAAGCAGTCGGGCGGCATGA
GCTCGTTCAGGTTCCCAACTGCCGAGGAGGTCGGTGGCGGGGCTGAGTCT
GGGTTTGGGCAGGCTGGGGAAGATGATGATCTGTACAATTAAACAGGTAT
TTTTTTTTTTTGCCGATCTGGGGCTGGGGGGTAGCATGCGATATACACTA
GCACATTGAGGTAAATGTGGTTCGTGGAGGCAATCGGGGCTCGTTTCTTG
TTTCGAGAATCATGTTTGATATAAAACGAGCTTTTACTTACTATATGAAG
CTTAAATCCTTCATGAACTCGTCTTTGTGTTTTTAGCTTTTCTGGTTTTA
TGGTTCGTTCACGATAATGGAACACTTTGATGACATAG

Sequences in the Contig:

SY0AAA11YP03FM1 SY0AAA13YJ11FM1 SY0AAA14YE09FM1
SY0AAA14YK24FM1 SY0AAA15YH24FM1 SY0AAA18YE09FM1
SY0AAA20YE13FM1 SY0AAA22YF20FM1 SY0AAA22YF20RM1
SY0AAA22YK04FM1 SY0AAA22YK04RM1 SY0AAA23YE10FM1
SY0AAA23YF06FM1 SY0AAA25YO17RM1 SY0AAA26YE24FM1
SY0AAA28YN11FM1 SY0AAA31YO03FM1 SY0AAA33YF17FM1
SY0AAA33YH08FM1 SY0AAA36YI14FM1 SY0AAA36YK11FM1
SY0AAA37YB18FM1 SY0AAA37YG01FM1 SY0AAA37YL08FM1
SY0AAA38YC14FM1 SY0AAA38YO09FM1 SY0AAA3YB04FM1
SY0AAA3YK01FM1 SY0AAA40YH22FM1 SY0AAA40YP17FM1
SY0AAA41YC14FM1 SY0AAA41YF03FM1 SY0AAA45YG14FM1
SY0AAA45YP04FM1 SY0AAA47YH23FM1 SY0AAA47YK02FM1
SY0AAA50YO10FM1 SY0AAA58YC18FM1 SY0AAA58YI13FM1
SY0AAA60YP18FM1 SY0AAA61YK07FM1 SY0AAA61YN15FM1
SY0AAA62YA01FM1 SY0AAA62YE07FM1 SY0AAA63YC13FM1
SY0AAA8YG01FM1 SY0AAA8YG06FM1 SY0AAA9YC03FM1
SY0AAB13YJ13FM1 SY0AAB16YK03FM1 SY0AAB19YM01FM1
SY0AAB22YA17FM1 SY0AAB24YB04FM1 SY0AAB25YM05FM1
SY0AAB29YN20FM1 SY0AAB30YK08FM1 SY0AAB31YO09FM1
SY0AAB33YK22FM1 SY0AAB35YG01FM1 SY0AAB37YA02FM1
SY0AAB41YL01FM1 SY0AAB43YB20FM1 SY0AAB43YG10FM1
SY0AAB47YF08FM1 SY0AAB4YE21FM1 SY0AAB53YB20FM1
SY0AAB53YH20FM1 SY0AAB54YE16FM1 SY0AAB56YN21FM1
SY0AAB57YE10FM1 SY0AAB61YC24FM1 SY0AAB7YE19FM1
SY0AAC10YM19FM1 SY0AAC10YP20FM1 SY0AAC11YM20FM1
SY0AAC17YB04FM1 SY0AAC25YD09FM1 SY0AAC25YD09RM1
SY0AAC26YK02FM1 SY0AAC35YN02FM1 SY0AAC37YA06FM1
SY0AAC38YJ10FM1 SY0AAC39YO04FM1 SY0AAC45YN02FM1
SY0AAC45YN04FM1 SY0AAC48YE15FM1 SY0AAC49YF15FM1
SY0AAC50YK16FM1 SY0AAC51YH16FM1 SY0AAC54YH20FM1
SY0AAC60YA06FM1 SY0AAD18YP13FM1 SY0AAD36YH07FM1
SY0AAD41YG14FM1 SY0AAD47YM21FM1 SY0AAD50YP21FM1
SY0AAD53YC14FM1 SY0AAD53YE24FM1 SY0AAD60YN14FM1
SY0AAD6YC06FM1