Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1139
Length(NT) : 1378
Best Gene Model Blast : Link to GSTUMT00009533001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein MGL_3762
Accession: ref|XP_001729295.1| Score: 659 E_value: 1e-109
KEGG Definition: chaperone HSP104 and related ATP-dependent Clp proteases
Accession: aor:AO090038000288 Score: 930 E_value: 1e-98
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG1051 Score: 674 E_value: 3e-71
PFAM Definition: AAA_2, ATPase family associated with various cellular activities (AAA). This Pfam entry includes some of the AAA proteins not detected by the pfam00004 model..
Pfam Number: pfam07724 Score: 545 E_value: 3e-56
Swissprot: P33416|HSP78_YEAST
Gene Ontology:
GO:0005759 = Cellular component: mitochondrial matrix
GO:0051082 = Molecular function: unfolded protein binding
GO:0000002 = Biological process: mitochondrial genome maintenance
GO:0006457 = Biological process: protein folding
GO:0030150 = Biological process: protein import into mitochondrial matrix
GO:0006950 = Biological process: response to stress

Sequence:
>Contig1139
TTGGGGCTCGAAGCCGTTTTAAAAGAAAAACAAGCAAAGGTCGAGGAGCT
CACGAGCGTTTGGGAGGAAGAGAAGGCCAACCTCCAGAAGATCAAAACTA
CGAAGGAGGAGTTAGAGCAAGCGAGGGTTGAGCTTGAGATTTGTCGAAGA
GAAGGTAATTTCGAGAAAGCATCTATGTTGCAATACGCGAAGATTCCCGA
ACTGGAGGCCAAACTCCCCAAGGATGGGGAAGTGAGTAAAGGTGCACTTC
TCCATGATTCGGTGGGCCCAGACGATATTGCTCAGGTTGTTTCTAAAGCC
ACGGGCATTCCCACCACTAAACTTATGTCTGGGGAAGTTGAGAAACTGGT
TCATCTTGAGGATACTCTTCGGCAGTCAGTTCGTGGGCAAGACGATGCTC
TCAAGTCAGTTGCTGATGCCGTCAGGCTCCAGCGTGCCGGATTAGCCAAC
GATCACCGCCCCACTGCCAGTTTCATGTTTCTAGGACCCACGGGTGGTTG
GAAAGACAGAATTATGCAAAGCATTGGCTACGACCTTATTCGCAAGCGAG
AATGCAGTTATTCGATTCGATATGAGCGAGTTTCAGGAAAAACACACTAT
CAGTCGGCTGATTGGAAGCCCAGCTGGCTATGTCGGTTACGAAGATGCGG
GACAGTTAACAGAGGCCGTCAGAAGGAAACCGTATGCGGTTCTCTTATTC
GATGAATTTGAAAAGGCCCATAAAGACCTCTCCTCGTTGCTCCTTCAGGT
CCTTGATGAAGGCTTCCTAACAGATGCTCATGGTCGGAAGGTCGATTTCC
GTTCCACAATCATAGTTCTCACGTCCAACATCGGTCAAGACATCCTTATC
AATGACCCATCCTCAGACGTCGCAATATCGCCAGCTATCAAGCAACAGGT
CATAGATATTGTACAGCATTCCTACCCACCAGAATTCCTCAACAGGATCG
ACGAATTTATAATTTTCCAGAGACTCTCGAAGGATGCTATTCGAGATATT
GTTGATATTCGATTGAGGGAATTGCAGGAAAAGCTTGACGATCGTCGGAT
TAAACTCGACGTAGATGCCAAAGCAAAGGATTGGCTCAGTGAGAAGGGAT
ATGACACTCGATACGGCGCAAGACCATTGAACCGCCTTATTGGCAAGAAA
TTATTGAATCCATTGGCAGAGAGATTGATTCGTGGAGAAATAAGGAATAG
TGAAGTAGCTAGGACTAGGGTCGCACAGGAAGGAACAGAATTGGAAGTTC
TCCCAAACCATCAGCCCTCCACTAGCTCCAATCAGAGGTAAACATTGGAT
CCTTTAGAGGATTAACTTAATGGGCTGTGACCAGCTTGGGTTTTTGGAGA
ATCTGGTTTGATGCATAATATACGTATG

Sequences in the Contig:

SY0AAA42YO11FM1 SY0AAA46YH10FM1 SY0AAB42YG16FM1