Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1138
Length(NT) : 1461
Best Gene Model Blast : Link to GSTUMT00005856001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG4462 Score: 208 E_value: 4e-17
PFAM Definition: Extensin_2, Extensin-like region..
Pfam Number: pfam04554 Score: 208 E_value: 4e-17

Sequence:
>Contig1138
TTGGGATCTCCGCTGTGCCATCGCCTAAGGGTGCGAATGCTCCGTTGGAT
GTGAATAATGATGGTTACGAACCAGCGCCTGCGCATGGACGCCCTTACTC
GCCTCCTGCAAGCCCTCGATATTCAACCACTAGCCATCTTAAATCTCCTG
CTGCTCCTCAGCCTGTTCGCCCAGCAAACATGGCACGTGTGGAATCACAG
GGTCCAAGAGGCATTGTTGAGATTGAGGATGATGGTGATGAAATTCCATA
TTCAAGATATGCAGGCAATCCAGAGAGAGAGCTTCGTAGAGATAATGTCT
CTCCAATTTCTCCAGTTCCTCTTATCAAACAAGAACCGAGATCACCATTC
CCTGATGTTCACCCCCCGCGTGTCACAAGGGTGGGGGGTCCTGCAGACAC
GTACGATGAACGCCAGCGTCATGATTACCCCCCAATTCCCCCACCACCCC
AGCGCTATAGTTACCAACCTACAGTTCACCCACACCCACCCGCGGCGGGC
CATCATGTGTACGATTCCTTTGGGTATCATCTACCTCCGCCTCCACCACC
TCCAGCACCTGCGCCTGTATATACTCGCTATCCACCTTACGATCCAGAAT
ACTATCATGCTCCTAGACCGTATGACGAGTATGATCGTAGATACGCGGCG
CCATCTGCGGTCCCCTCGCGCCTTCCCACACGCTCCGGTAGAAGGTCGGC
GTCGCCCGTCAACTACTCTCAACGTTCACCGCGCTCTGTTTCGCCCTCTA
GGGTTCGCAATCCAAAAGATTCGCGTCCAGTCTCCCGGGCAGAGTACAGA
CCACCCAGTAGAATGACTAGACCACCGTCCCCTCATCGTCTCGACATGTA
CAGCAGGCCTTACCCACCACCCCAGCCTCCTATGTATCGTCCCGAGTACC
CCGGAGATTATGCGTCTTATTACGGGCCGCCTCGTGAGAGACCTACGGGT
TACTATGATCCTTATCGTTCTATGCGCTTTGACGAATACCCGCCGAGACC
CGAGAGCAGCGTTATTCCTAGGGGGTTTGATGACAGAAGTTATAGAACTC
GAGATTATCCCTATGTTCCGGCGAGACCATCGATGCCACCACCTCAACCA
GTGACAGGTGGCTATGCCCCCGAGCATAGAGCAGATTACCCCTCCTCTTC
TAGGGCCAGTGTAAGGCCAGAAGACCATCTAGAGCGTCGCGTTGAATACA
GGCCTGAGGCTAGCAGAGCTAGCCCGAGACGTGAAGACCGCCCGTATTCC
AACGGTGTGGACAACTACTTTCATGGTAGAGAGCCTTCAGTTAGACATGG
TAGTGTGAGGCCTGACCCAACCAGGGCTTATGGCGAAGGGGAATATGCGC
CGAGGAGACAAGCAAGTGTCAGGCCGGATGCTGGCTTCAGGGACCGGTTC
GCCGATCCGGGTCCTAGAGAGCCAGGACACATGCAACCACCTCACCTTGT
TCCTCCCTATG

Sequences in the Contig:

SY0AAA42YN19FM1 SY0AAB60YH03FM1 SY0AAD27YC24FM1
SY0AAD35YG05FM1