Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1137
Length(NT) : 615
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1137
TTGGCCACAAAAAAGTAACATTTCATCGGTTGTTTCGGCTTGCATTAATG
AGAAAGGGAGCAAAGAAAGGTTTAAAACATGGCGCAATATTTGGGGTTTT
GTTGGCTTTTTGCTTTTGACTGCTTTATGATTTCTCACGATCCCTCTCTA
TATCAATTTCTTCACCCTCCTAAATGAAGTTTCTTTTTCCTTTTTTCTCG
TTTCTTCATGTCTTTCGTCGGCAGCGTTCGGAAACACAGGTTGTTATGCA
ATTGGGTATAGACGGCTTCCAACTGGGGTTTCTGCTTTTTTTTTTCCTTG
TTACTCCTCACAAGTTCTGCTGAGACTGGGCAATACTGACCTGGGGAAAT
GAGATGGATTTATGGGGTGAGAGGGTTCTATCCCTCTTTTTTTTGCTTGC
AATGTTTTCTGTTCTGCTTTTTATCTCTTTTACTATTTTTTCATGGGGTT
TTTTTTTTCTATCCAAGGGGCACACACACGAAAGAAGGAAAGTTTTATTC
ACATCTACCCGGCGTTGTTGATTGTGGGGTCTTTCATGGTTCATGACGTT
TGTTTTTTCCTTTGCATCATGAATGGTCGGTTGGGTGGTTTTTTTTCTTC
TTCCCTTTTTCTTTT

Sequences in the Contig:

SY0AAA42YN16FM1 SY0AAD35YF05FM1