Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1136
Length(NT) : 1166
Best Gene Model Blast : Link to GSTUMT00009346001 E-value : 0.0
Numbers of ESTs : 11

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE55863.1| Score: 845 E_value: 2e-88
KEGG Definition: ubiquitin fusion-degradation protein
Accession: aor:AO090005000853 Score: 845 E_value: 8e-89
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG1816 Score: 742 E_value: 3e-79
PFAM Definition: UFD1, Ubiquitin fusion degradation protein UFD1. Post-translational ubiquitin-protein conjugates are recognised for degradation by the ubiquitin fusion degradation (UFD) pathway. Several proteins involved in this pathway have been identified. This family includes UFD1, a 40kD protein that is essential for vegetative cell viability. The human UFD1 gene is expressed at high levels during embryogenesis, especially in the eyes and in the inner ear primordia and is thought to be important in the determination of ectoderm-derived structures, including neural crest cells. In addition, this gene is deleted in the CATCH-22 (cardiac defects, abnormal facies, thymic hypoplasia, cleft palate and hypocalcaemia with deletions on chromosome 22) syndrome. This clinical syndrome is associated with a variety of developmental defects, all characterised by microdeletions on 22q11.2. Two such developmental defects are the DiGeorge syndrome OMIM:188400, and the velo-cardio- facial syndrome OMIM:145410. Several of the abnormalities associated with these conditions are thought to be due to defective neural crest cell differentiation..
Pfam Number: pfam03152 Score: 631 E_value: 3e-66
Swissprot: O42915|UFD1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig1136
TTGGGCGCAGCCTCTGAAGCTCTAAGCTGGATTCCCGTCATCAACATCAT
CACCCCAGCCATCAGGCCTCTTTCAACATGTTCGGTGGAAATTTCTACGA
CGACGAGGTTATGGTCCCTAGCTACCACCCACGCAACCGGCGCTTTGATG
AATTCCTCCGCTGCTACCCCATCGTCATGATGTCGGGAGCGGAGCGCGCG
GAGTTGAACTTCGGTGGGAAAGTCATCATGCCGCCGTCTGCCCTGGATAA
GTTGTCGCGGCTGCACATCGCCTATCCGATGCTGTTTGAGCTGAGGAACG
GGTCGAAGGATAAAGTCACTCACGCGGGTGTGTTGGAGTTTATTGCGGAA
GAGGGGAGGGTTTACTTGCCACATTGGATGATGAAAACCCTCCTCCTAGA
GCCTGGCGAGCTCCTCCAAATTAAATCCACCGACCTCCTCGCGGGGACAT
TCATAAAGCTCCAACCCCAGTCGACGGCCTTCATAACGTCCATTACAGAT
CCCAAAGCAGTCCTTGAGAATGCACTGAGAACTTTCTCTGCACTGACGGT
TGGCGATGTATTTTCCTTCTTTTACAACGACCAGGTCTTCGATATTGCTG
TGTTGGAGGTCAAGCCAGAGACCAAGATGAAGGCCATAACAACCATTGAA
ACGGATATATCTGTCGACTTTGCTCCCCCGGTCGGGTACGTCGAGCCTAG
CCGTGCTCCGCAGCCATCAAGACCCGGAAGCGTGGTTGGGGGGAGAAACA
TAACACCATTGGGCGAAACAGGCAGCATGGCCAGGAGCATAAACTATGCA
GCTATTGCCCCGTCTGGCGCCGTCATCACCGCCGCCCCCGGAGCAAAGCA
ATCCTTCTTCGCAGGAGGCGGCGGTCAAAAGCTCAAGGGCTCGAAAGCTA
ACACTCCAAGGGATAAGCCTAGCACCCCTGTCGCCGGCGTTTCCTCGAAT
CCCCCGCCACTCGCCATCCCCGCACCAACTATTAGGAGAGGCACAGGCCC
GCAACCGCTCCGCCTCCCCCCCGGACAACTATTCTTTGGGTACGAGAAAG
AAAAGGGGGGATGAGGCGGGCAAGGGAAAGGGAAAGGGTCTGGAGGTCAT
TGAAATTGATTGATTAGTTTGGGGGGGGTGTTGCTTCTTTCCTTTTATCT
CTTTGTGATAGGGAAT

Sequences in the Contig:

SY0AAA42YN10FM1 SY0AAB20YI10FM1 SY0AAB36YK08FM1
SY0AAB37YD22FM1 SY0AAC45YP14FM1 SY0AAD10YI03FM1
SY0AAD23YL13FM1 SY0AAD32YD08FM1 SY0AAD36YF04FM1
SY0AAD36YJ20FM1 SY0AAD63YL24FM1