Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1135
Length(NT) : 989
Best Gene Model Blast : Link to GSTUMT00000065001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein CIMG_06694
Accession: ref|XP_001242798.1| Score: 724 E_value: 1e-74
KEGG Definition: DEAD box helicase involved in nonsense mediated decay, putative
Accession: afm:AFUA_5G09090 Score: 642 E_value: 2e-65
KOG Definition:
Classification: [Replication, recombination and repair].
Kog Number: KOG1807 Score: 537 E_value: 2e-55
PFAM Definition: No Hit Found
Swissprot: Q8R151|ZNFX1_MOUSE

Sequence:
>Contig1135
TTGGATAACATGCTACCCTTCGATATGCTCCAAAAACAGAGACGTATGAG
ACCAGAGATCCGTGAGTTACTAACGCCGATTTATCAAGACTTGGTTGAGG
ATAGTTGTGTTCTGGGTCGGCCGGGTATCCCTGGGATGGGTGATACTCAT
GTATTCTGGTACTCTCATATGAATCCGGATCAAATGGATAGTGGCACATC
CCGTATCAATACCGAAGAAGCCGCCATGATAGTTGGCTTCATCGAGCATC
TCGTACTGAACAAAACACGCCCTGAGAAAATTACCGTTCTCACCTTCTAT
GGTGGGCAAAAGCATGAGATCATTAAGCGTGTCCGAAAGAACAACAACCT
GAAGTCCTGCGACCTCAGAATTACCACTGTGGATAGCTACCAAGGTGAAG
AAAACGATGTTATAATTTTGAGTTTGGTGCGGAGCAATCCTCAGGGGAAT
GTGGGGTTTTTGAACGTCCAAAACCGTATTTGTGTTGCTCTGTCTCGCGC
ACAGCTTGGGTTCTACATCTTTGGGGATGCACAAATGATTACTAGGGCAG
ACAAGACTTGGTGGGAGATTGGCAAGATTCTAAATACATCCCCAAGTCGG
ATTGGCTTTGCAATGCCAATTGTTTGCCAGAGACATGGGAAGCTCGAATT
TATCAAAGAGAGCCAGGACTGGGTCGATATAGTCGGGGGATGTTACCAAT
GGTGCAAAGAATTATTGCCTTGCTCGCATACCTGTCGCTTTAGATGCCAC
CCATTCGATCACAAGGATATCCGATGCCTAGATCCCTGTCTTAAGCGCCT
TGTATGCGGCCATCAATGCCAAGAGGATTGTTACAAACCTTGCTACTGCC
CAAAGTGTGATGAGAAGCGAGTGCTTTCCGACGAAAGATCAGACCCCTCA
AGCCCCAGAGCATCGACCCGTTCTGAAAGCACACCAAGCTGTCTCACCCC
TGTTCAGCCCACTACCTCCTCTTCTCTTATAGATACGAG

Sequences in the Contig:

SY0AAA42YN06FM1 SY0AAA58YJ24FM1 SY0AAC15YJ15FM1