Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1134
Length(NT) : 1366
Best Gene Model Blast : Link to GSTUMT00010229001 E-value : 0.0
Numbers of ESTs : 21

Blast Results:

Nr Definition: nitrite reductase
Accession: gb|ABI98041.1| Score: 1682 E_value: 0.0
KEGG Definition: nitrite reductase NiiA [EC:1.7.1.4]; K00362 nitrite reductase (NAD(P)H) large subunit
Accession: afm:AFUA_1G12840 Score: 1086 E_value: 1e-116
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG1336 Score: 363 E_value: 4e-35
PFAM Definition: Pyr_redox_2, Pyridine nucleotide-disulphide oxidoreductase. This family includes both class I and class II oxidoreductases and also NADH oxidases and peroxidases. This domain is actually a small NADH binding domain within a larger FAD binding domain..
Pfam Number: pfam07992 Score: 461 E_value: 2e-46
Swissprot: P22944|NIR_EMENI

Sequence:
>Contig1134
TTGGTCCCTTCCTAGCACTCCCGCTATCTTGCGGGTTGTGGAAAGGCTGT
TATCAACTGTGGCAAACTTGACTTATTGATAAAGTGCTGCGATGGATTAT
TTTCTGGACCTTCTCTGTCTCGTTATCCTCCTGTTTCTAAGTCGTTATTC
ATCTAGCCCCACAAAAATCCCCGTAACAATTGACCTTTCTCTGACTACCA
AGAGCGAAGACACAATATTAGCGCCGGTGGTGATGGACAGCAAACCTTCA
ATTGCCAATGAGGATGGCCCGACTGAAACGAATGGAGCCAACGGAATGAC
GAATGATATGTCAGGTGGTGAAAATGGCACAGCCCCACCATCGCCCCAAA
GAAAACGAATAGTAATTGTTGGCCTGGGGATGGTAGCAATTGCATTCATT
GAAAAGATCCTAAAGCTTGATGCCGAAAGCAAACAGTACGAGATCGTGGT
TATCGGGGAGGAGTCTCATGTGGCATACAACCGTGTGGGATTGACTTCAT
TTTTCGAACACCGAAAGGTCGAGGACCTCTACTTGAATCCAAAAGAATGG
TATGAATCAAAACCGGGTGTCCTAAACCACAAAATCAACACCAAAGTCAC
AGCCATCGATCCTATATCAAAATCAATAACAACATCCGCCGGCTACGATG
TAACCTACGATATTCTAGTGTTAGCAACTGGCTCCGACGCTGTTGTCCCA
TCAAATACGCCCGGACATGACAGCGAGGGAGTATTTGTTTACCGGAATAT
CGAGGATTTGGAGAAGTTGATATCATTCTCTGCCACAGTAAATGAATCAA
CCGGTTGTGTAGTGGGTGGTGGATTACTTGGTCTTGAAGCCGCGAAAGCG
ATGATGGACCTCGAGCGGTTTAAATATGTCAAGCTAATTGATAAAAACCC
TTGGGTTTTGTCAAGACAGCTAGATCAAGATGCCGGGAGATTGGTGCTTG
AGAAGGTTACAGAGCTGGGACTTGACGTATTAAGTTGCAGAAAGATTAAG
ACGATCAATTCCGACGAGAATAATCAAACCAAGAGTGTCACGTTTGAGGA
TGGAGAGACCATGGAAACTACATGTATTTGCTTTGCAATTGGTATCAAAC
CTAGAGATGAGCTCGCTGATAGTGCCGGAATCAAGACTGCCAGTCGCGGG
GGTTTTATTATTAACAAAGACGTCGAAACAACAGTCCCTGGGATTTATGC
GATCGGGGAATGTGCTTCATGGGAAAACCAAACTTTCGGTCTGATTGCTC
CCGGAGTCGAGATGGCCGACGTCCTTGCATTCAATCTCTGCAAATCGACT
TCGCATGGCCATTCTGAGGCACCAAAAGCTTTCAGACGCCCTGATCTCTC
AACCAAACTGAAGTTG

Sequences in the Contig:

SY0AAA11YF22FM1 SY0AAA17YA13FM1 SY0AAA17YL23FM1
SY0AAA23YL18FM1 SY0AAA42YM24FM1 SY0AAA43YI23FM1
SY0AAA47YG08FM1 SY0AAA54YF09FM1 SY0AAA62YM12FM1
SY0AAA7YF24FM1 SY0AAA9YJ24FM1 SY0AAB18YJ19FM1
SY0AAB20YF07FM1 SY0AAB20YK06FM1 SY0AAB22YA18FM1
SY0AAB24YL13FM1 SY0AAB28YF23FM1 SY0AAB47YG11FM1
SY0AAB47YP21FM1 SY0AAC61YK12FM1 SY0AAD18YJ19FM1