Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1133
Length(NT) : 888
Best Gene Model Blast : Link to GSTUMT00006788001 E-value : 0.0
Numbers of ESTs : 21

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001546498.1| Score: 163 E_value: 1e-09
KEGG Definition: hypothetical protein
Accession: fgr:FG07072.1 Score: 130 E_value: 4e-06
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1133
TTGGGTAACTTTGGGGCAGAGAGATCCCCACAGCTTTTCCCATCCAACCA
AGACTGACGGATATTACGCGTCATTGGTGTTGGCATTTTAGTGAGGGGAG
GGGGGGGTTTCAAAAGAAAAGGTGCTCGCACATTTTTTCTCTCCCTTTCG
GCAAACTGGGCCACCGGCATTCTGCTATTATCATACCATTCTTTTTTCTG
TGAGGGAGGCACACCACTCACCACCTGTCACTGCTCACCACGCCTACGCC
GCCATTGCTGCTGCGAGAGAACCATTTGGATACGGAGAGTGCACTCGCGA
GCGAACGAAGTAGGAAGGGGGCTTTTTTTTTTTTTGCGTGTAAATCTCCG
AAAGTTGAAAATATCGGAGGGAGTGATGGATAAAAACGAGAGGGGGTTTT
CAAGGGTTTTTAGGAGAGATTATTATGACCGATGCGACTTTGGTGACTGC
TACTCTAGCTGGGACAACTGGGGACGATGGGTAGCTTTAACTGTTATCGT
TGTATTCTTCTTCCTCGTCGTCGCTTGTTGCGGACTAATAACCTCTCGCC
GCCGCCGCCGCGCGGGCATGCAACCAGTCTATGGCACCGCATGGATGGCC
CCACCAAAATACACTCCGCACGACGTCCACCAGTTTCAGACCTACCCACC
GCAACACTACCCCCCTCAGCAACCAGGCCCTTACGCACAATACTACGCAC
CCACACACCCAGCGCCGGCATACTCCCCCGGCCAGCAGAACCACGATCCC
GGTGCTCCGGGACATGCTGGTGGGAATTATCATGCTGCTGGTGTGGAAGA
TCCTCAGGGACAGCAAAGGCAGTATTTCTCACCGCCACCAGTGCCGCTGG
GAAGTCCCGAGCCGGCCGCGCATGCTCCCGTTAATGGA

Sequences in the Contig:

SY0AAA10YE23FM1 SY0AAA24YN19FM1 SY0AAA40YA08FM1
SY0AAA40YI05FM1 SY0AAA42YH20FM1 SY0AAA42YM19FM1
SY0AAA56YN08FM1 SY0AAA63YK17FM1 SY0AAB22YN19FM1
SY0AAB36YL19FM1 SY0AAB39YE24FM1 SY0AAB45YH24FM1
SY0AAB56YF13FM1 SY0AAB58YE18FM1 SY0AAB59YK15FM1
SY0AAB5YP04FM1 SY0AAB61YE14FM1 SY0AAC25YK18FM1
SY0AAC3YH23FM1 SY0AAC9YG02FM1 SY0AAD2YJ17FM1