Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1132
Length(NT) : 724
Best Gene Model Blast : Link to GSTUMT00008227001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001209102.1| Score: 663 E_value: 9e-68
KEGG Definition: predicted protein
Accession: aor:AO090020000188 Score: 633 E_value: 1e-64
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG0161 Score: 123 E_value: 1e-07
PFAM Definition: Myosin_tail_1, Myosin tail. The myosin molecule is a multi-subunit complex made up of two heavy chains and four light chains it is a fundamental contractile protein found in all eukaryote cell types. This family consists of the coiled-coil myosin heavy chain tail region. The coiled-coil is composed of the tail from two molecules of myosin. These can then assemble into the macromolecular thick filament. The coiled-coil region provides the structural backbone the thick filament..
Pfam Number: pfam01576 Score: 112 E_value: 2e-06

Sequence:
>Contig1132
TTGGCAACTCTGCTACCCCCGGGGGAAGTTCTAGTCGTCAAACACAACAC
CAGACTATAACCAGCAGTTTCCCGCACGCGTTTGAACGGTGGGAACGGCT
TTCTTCGCGATGGGAGGGGCTAACCGGATATTGGATCTCGAGATTGGAAC
ATAACCAGGAGGAGTTGGCTGGTATGCCCATAGAACGGGAAATGGCTAGA
CAGATTAGCGATCTTTCTACTGCTGGTGCGAATCTGTTCCAGGCTGTTGT
AGAGCTACAGCGTCTTCGCGCTTCTTCGGAGCGAAAATTCCAACGGTGGT
TCTTTGACACTAAGGCTGATCAGGAGAGAGCTAAGGAGATGAGCAGCGAA
CTGGAGCGTTCCTTGCGTGTAGAGCGTCAACAGCGTGCAGACGCTGTCAG
TCAAGTCCAGAGACTAGAAAAGGAGAAAGCGACAGCGGAGAAACTTGTTG
AGGAGATGAGGAGAGAGTTGCAGATTTCGAAAGAAGAATGCAGACGTTCC
TGGGAGGAATTGGGACGAAAGGAGCAGGAAGAACGAGAAAAGACTAATAG
TCTCAAAGAAGGAAATCCAACACTCGTCGGTGGAATTCAAGTATTCCCAA
TGCCTATGCGTGGGGTTCCTGACAGAGGCTCGAATAGACCCCGAACAGCT
GGAAGCAGCAATACTGGGGCTACTCCTCAACCGATGACGGAAGAACAGTT
TCGTCAACAGTTCCAAGACAACGG

Sequences in the Contig:

SY0AAA42YM12FM1 SY0AAA46YC19FM1