Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1131
Length(NT) : 1431
Best Gene Model Blast : Link to GSTUMT00005266001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: serine/threonine protein phosphatase PPT1
Accession: ref|XP_753963.1| Score: 1606 E_value: 1e-176
KEGG Definition: serine/threonine protein phosphatase PPT1 [EC:3.1.3.16]; K04460 protein phosphatase 5
Accession: afm:AFUA_5G06700 Score: 1606 E_value: 1e-177
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0376 Score: 1321 E_value: 1e-146
PFAM Definition: PPP5, PPP5. This domain is specific to the PPP5 subfamily of serine/threonine phosphatases..
Pfam Number: pfam08321 Score: 294 E_value: 3e-27
Swissprot: P53042|PPP5_RAT

Sequence:
>Contig1131
TTGGCTTTATTCTATCATTCCCCACTATCTCCTTCTCCAGATCCCTCTCT
TCTTTATCTTCGAAACTAACCGCTTTGCCGTCCCTTAAAAACTGCGTAAG
CACGGACCAGTTCGGAATTCATTACATTCCTCTACACCAGAACCTTCGCC
GGAAAATTCCGAAAACAATAAAAATGACGAGTGCTTCAACGGAGGCGCTA
GAGTTGAAAGCCAAGGGGAATGCTGCGATAGCTAGTAGAGATTGGAAGAC
TGCGGTTGACTTCTACACTCAAGCCATAGAGCTCGATCCGAACCAAGCGT
TATTCTACTCCAATAGGGCCCAAGCACATATAAGGATGGAAGCGTACGGA
TCCGCCATCGAGGACGCAGCAAAGGCGATTGAGATAGATCCGGCATCCGT
TAAGGCCTACTACCGAAGGGCAATCTCCAACGTGGCACTCTTGAAGTACA
AGGAGGCTCTTAAGGACTTCAGGACTGTTTGCAAAAAAGCTCCAAACGAC
AAAGATGCCCGACTAAAAATGAACGAATGCGAGAAGCTTATTCGGAAGAT
TGATTTCCTGAAGGCTATCGAGCAGAGTGATCCACCATCTGCTGCTGAGG
GTCTAGATCTGGATTCTATAGTGGTTGAGAATGAGTACGACGGCGTTCGC
CTCGAAAAGGAGATGACACAGGAGTTCATCGACGATATGATCGAGAGGTT
TAAGAACGGCAAGACAATTCATAAGAAATACGCATACCAGATTATCCTCA
AGGCGAAGGAGATATTCTACGCCGAGCCAACCATGCCAGAAGTCACTATC
CCAGACGGCAATAAGATGACAATTTGCGGGGACACCCATGGTCAATATTT
CGATCTGTTGGAGATCTTCCGTCGCAATGGATTCCCGGCAGAGACGCACG
CATATTTATTTAACGGTGACTTTGTTGATCGGGGATCTTGGTCCACTGAG
ATTGCTTTCCTTTTGTTCTCCTATAAATGGCTCTTCCCCAACAACTTCTA
CATAAATCGTGGCAATCATGAGACGGATGACATGAACAGGGTTTACGGAT
TTGAGGGAGAGTGTAAAGCCAAGTACAATGAGCGCATGTTCAAATTGTTC
TCGGAAGCATTCAGCGCTCTGCCTTTAGCTACGCTAGTTGGCTCCAAGTA
CCTGGTTCTTCATGGAGGGTTGTTCTCCGACGATAAGGTTAATCTAGATG
ACATCCGAAAGTTGAACCGTCACTTGAAGAAGCAACCTGGACAGGAAGGA
CTAATGATGGAGATGCTGTGGACCGATCCACAGCCTGACCCTGGCCGCAG
ACCTAGCAAGCGTGGTGTTGGTCAGCAATTTGGTCCGGACGTTACGAAGT
CTTTCTGCGAGCGCAATGGGTTAGAAGCCATTATCAGAAGTCACGAGGTC
CGGATGGGAGGCTACGAGGTGGAGCACGATG

Sequences in the Contig:

SY0AAA1YC04FM1 SY0AAA33YI21FM1 SY0AAA42YM07FM1
SY0AAA60YB06FM1 SY0AAB35YA21FM1 SY0AAC14YB18FM1
SY0AAC28YF07FM1 SY0AAD51YM17FM1