Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1130
Length(NT) : 1081
Best Gene Model Blast : Link to GSTUMT00007217001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE64562.1| Score: 507 E_value: 2e-49
KEGG Definition: ankyrin
Accession: aor:AO090138000202 Score: 507 E_value: 1e-49
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0509 Score: 227 E_value: 1e-19
PFAM Definition: No Hit Found
Swissprot: Q1RJR6|Y317_RICBR

Sequence:
>Contig1130
AAGGCACAGAAGGGAAACAGACCAATACTCGGACTGCAGGTCCTCATGTG
GGTGTTGTATTCGGAGCGGCCATTGCGGGCCGCGGAACTCTGTCATGCCT
TGGGAGTGGAGGTGGGATCTACGGATCTAGATGTCGAAAATATTCCCGCA
TTACGGACGCTCCTAGCATCTTGTCTTGGTCTTGTCACTGTCGAGGCGTC
TTCTTCCACTGTCCGACTGGTACACTATACTCTGCAAGAGCACCTCTCAA
GCGATCCAACACTATTCCATAGCCCTCACTCAACAATTGCGGAGGTTTGT
TTGACATACCTCAATTTTGAATGTGTCCGGGATCTCTCGCCAACACTTGA
ATCAGCTCCGGCAGCAATGCCACTTCTAGAATATGCTTCTTGTTACTGGG
GGGAGCACATAAGAAGGGACATGACGGAAAATGTGAAAGTGCTTGCACTG
AGACTTTTGGATAGATTTGATGAGCATATATCTGCAAAACTAATATTATT
GCGTCTTCATCAGGATAGAGGCTTCCACCCCTACTTTAACCCATCTAGAG
GACCAATCGGATTTACAGGGCTCCACGGAGCGGAATTTCTCGGGATCGTA
AGGGTAGTTGCTTCTGTATTGAAGATGAAGGAATGGGATGTTAATGCAAC
CGATAGCATGGGGACTACAGCTCTCATATGGGCGGTGAGAAGAGGGCATG
AGGAGGTGGTAAAGTGGCTTTTGGATCTGGGGGATGTCAATCCTAATCAG
GCAGACACGAAATATCGCCAGACGCCACTCTTGTGGGCCGCTGAGAACGG
GAATGAGGCGGTAGTAAAAATGCTTTTGGAACGAGTGGATGTCAATCCCG
ACCAGGCAGACAAATACGGTCAGACGCCACTCCCGTGGGCCGCTAACTAC
TGCCATGAGGCGGTAGTAAAGATGCTTTTGGAACGAGTGGATGTCAATCC
CGACCAGACAGACACCGAATATGGCCAGACGCCACTCTCGATGGCCGCTG
AGAACGGGCATGAGGGGGTAGTAAAGATGCTTTTGGGACGAGTGGATGTC
AATCCCAACAAGGCAGACACTTTTTGTGGCC

Sequences in the Contig:

SY0AAA32YL01FM1 SY0AAA42YM06FM1 SY0AAB41YM23FM1