Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig113
Length(NT) : 1548
Best Gene Model Blast : Link to GSTUMT00005431001 E-value : 0.0
Numbers of ESTs : 30

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Transcription].
Kog Number: KOG3582 Score: 115 E_value: 2e-06
PFAM Definition: Mucin, Mucin-like glycoprotein. This family of trypanosomal proteins resemble vertebrate mucins. The protein consists of three regions. The N and C terminii are conserved between all members of the family, whereas the central region is not well conserved and contains a large number of threonine residues which can be glycosylated. Indirect evidence suggested that these genes might encode the core protein of parasite mucins, glycoproteins that were proposed to be involved in the interaction with, and invasion of, mammalian host cells..
Pfam Number: pfam01456 Score: 113 E_value: 4e-06

Sequence:
>Contig113
TTGGCTCCCCTACTTCGCTCCAACCCTCCATCAAACCATCTTTGTTCCCA
TCACTCTCTCTACCTCTGGGTGCTATTGTCTTCAAACCCTAGTCAGTCGC
TACGAATCACCCTCCCGGAACCCAAGCGCCTTCTCCCCGTTTCCTCTGAC
ATACGCGTTTCGTCTGAAGAGAGAACCGCCAAAAAATAAAATAAAATAAA
AAAACAGCCCTTTTTAGGCTTGGTGATTTCAAAAGAGCCCCACACCCAAC
CTCCTCTCGATTTCTTCATTCAGTGTTTGAACAGACTTCTCGCGAACACT
CAAGGTTTACCAAGGGAAAGACAAACAAATCTCTCCTCCCCCTCCACCCC
CTCCCTCCCCTTGCCCATACCTTCAATTGTCACTATCCATTACCATCTTA
TTTCTTCCCCTCTTCCTCCTGATAAGAACTTTGTCTGTTCCTATCAATCT
TCACAAGACGATGTCTCGTCGTTCGCTTTCCCTCTTGAGTTCGTTGCTCT
TTGTTCTGTTGCTCTTTACTCCCACCATCCTCGCGGACAGTGAGCAGCAG
TTCCAAGAACTCGCAAGGGACGTCCCGCAGGACAGACTCCATGCAGCCCT
TCACGACTACAATGGGGCTAAGTTCAAGCATGTCAAATTGGCGAAACGAC
AATCAAATACCACAACCACGAGCTCCCCCCCCAGCACCCCTCCCACTACC
ACTGCCCTCTCAGTCACTCCCACCTCTAGACCTTCGTCGGCTAGTCCGAC
AACGCGTCCGCCGACAACCACCCCCGAGCCAGCCACTACAGCACCCTCTG
CCGCCCCCAAAAGAGGAACTACTTCCCTCACCTCAAGACTCACCAGGACC
GTCACTGGTCCCGATGGCGTAGCCACTTTCACGGATGTCACCGTTGTTGT
TGCTACGCCCACTGATGAGGCCGCTGCCGCACCAGAGGAGACCTCATCAT
CGACTGCGCCCCCTGGTTCGCCCGGGCTTCAGAACGTTGGATTGAGGGTT
AGTGGAGGAGATAGTGCGATTGTAGCTGTTATTGCTGCATTGGGCTTCTT
CATGCTATGAGGTGTTTATGTGGTGAAATGGGCATGGCTTTCTTTCGATT
CTAACGGCCCATGAGCATTATATTTTTCTCTTCATCTTTCGTACGGATCT
CCTCCCCTTCTCTTGTGAGGCGGAAGTTCTTTCGTTGAGATGGAACGGCT
AGAATCTGGAGCCGGGGTACGTCCGGGATAATTGAGTTTAGAGGGGAAGG
GTGGATTATCGGCCATCCTTGCAGCAGATTGTTTTGCATTGCGGTTACTC
ATTTGTACTCTTTTTTTCTTGCTGTTCTTTACTATTCCTCCCTTTAGTAT
GCATTTCTGGGTTGGACATCTCTTACTATAATGTCTTTTTTCTGCACATA
AAGGCTCTGCTTCACGGTGTTTGTTTTAGCCATATCATACGTTTGAGGTG
GTGTTTTTTTTCCCCCCCCTCATGCTTTAGGATTCAATTTAAAAGCAACA
AAACATTGAATAACTTTGTGTTGCATAACTCGGAAAGTTTTTTTTTAG

Sequences in the Contig:

SY0AAA14YE04FM1 SY0AAA22YB22FM1 SY0AAA23YB13FM1
SY0AAA25YJ01FM1 SY0AAA26YN23RM1 SY0AAA40YD24FM1
SY0AAA42YG20FM1 SY0AAA43YA01FM1 SY0AAA46YB11FM1
SY0AAA4YP20FM1 SY0AAA50YG22FM1 SY0AAA56YH04FM1
SY0AAB36YC17FM1 SY0AAB39YC21FM1 SY0AAB39YI14FM1
SY0AAB40YF12FM1 SY0AAB41YI19FM1 SY0AAB46YG24FM1
SY0AAB47YD03FM1 SY0AAB48YN16FM1 SY0AAB55YO22FM1
SY0AAB59YO06FM1 SY0AAB60YD03FM1 SY0AAB60YM09FM1
SY0AAC13YJ15FM1 SY0AAC13YN24FM1 SY0AAC14YC16FM1
SY0AAC41YD12FM1 SY0AAC59YB15FM1 SY0AAD43YP16FM1