Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1129
Length(NT) : 1145
Best Gene Model Blast : Link to GSTUMT00004411001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein FG08385.1
Accession: ref|XP_388561.1| Score: 899 E_value: 8e-95
KEGG Definition: hypothetical protein
Accession: fgr:FG08385.1 Score: 899 E_value: 4e-95
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG1236 Score: 588 E_value: 2e-61
PFAM Definition: ABC1, ABC1 family. This family includes ABC1 from yeast and AarF from E. coli. These proteins have a nuclear or mitochondrial subcellular location in eukaryotes. The exact molecular functions of these proteins is not clear, however yeast ABC1 suppresses a cytochrome b mRNA translation defect and is essential for the electron transfer in the bc 1 complex and E. coli AarF is required for ubiquinone production. It has been suggested that members of the ABC1 family are novel chaperonins. These proteins are unrelated to the ABC transporter proteins..
Pfam Number: pfam03109 Score: 235 E_value: 2e-20
Swissprot: Q02981|YP109_YEAST
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion

Sequence:
>Contig1129
TTGGCTTCGATCTCCCCCTAAACCCATATTCACAATACGTCATACTCTTT
CTCGCTCATCCTACAGATCCCCCTTCACCACTTATTCAAACCCCTTTCCT
AACCAACCCATACGCTGGCCACGGCCCAACCGCAACTATACTCTCTGGAT
TGGCTCGGCTTCGCTGGCCTTCGCACTACATCTGGGTCTATCTCCCCCAT
TGACACTCGAAACTGGGGCGACTGGTTCAGAGAAAACCGCCGAGCAGTTG
ATGCTTGAGGAATCTGAACGGGAGCGCCTAGAGCCGTGCAGAGCTTTATC
AGGCCAGCCATTAATCCTTCGCATCCTCAAGAGGGCTCAGCTTCTTGCCA
TCAAATGTGTTATCGAACCGATTGCTACGGGGCTTCGGTTTGTGCATTTG
GTGGTGATTTTCCTTCCTGTTATCCTCTCGATACCACTGGCTTGTATCGG
CCCGCGGCAGCCAGACCGGTGTAGTGAACGCATTGGCACTATCTGGTGGT
ATTCCTTTTTGATCAAATCCATGGAGCGAGCTGGACCTACCTTTATTAAG
TTGGGGCAATGGGCAGCGTCTAGAACCGACATTTTTCCTGCCGAGATGTG
CGAGATGATGTCAAAGTTACATTCTGATGCCCGCGCCCACTCCCTTCGAG
ACACAAAAAGGACGATATCTCAGGCTTTTGGTGGCAGGCATTTTGATGAA
ATATTTGAGGAGTTCGATCAGAAGCCGTTAGGAATCGGGGCCGTTGCACA
AGTCTATCGGGCTAAATTAAGCCCGCATCTGCTACCAAGGTTACACGAAC
TTGGCGAAACGGATTTTAAAAAAAACCTCCGGCGGAAGGTTGATGTCCTC
GTAAAAAAAGCTCCCTATCAGGGTGTCCCCTCCTCGTACGTAGCAGTCAA
GGTGCTCCATCCCAAGGTAGACCGTACTGTCCACCGGGATCTCAGAATTA
TATACTTTTTTGCATCGCTACTCAATTTGGTCCCAACTCTTGAATGGTTA
TCTCTCCCAGATGAAGTGGACAAATTTAGTGAAATGATGAGATTACAGCT
GGATTTGCGTATTGAGGCGAATAACCTTAGCAGGTTTCGATCAAACTTTG
GAGATAGGACCACAGTCACATTTCCTCTGCCCTACAGCAACTATA

Sequences in the Contig:

SY0AAA42YL17FM1 SY0AAA46YD24FM1 SY0AAD22YF01FM1
SY0AAD34YK02FM1 SY0AAD39YL10FM1