Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1128
Length(NT) : 1010
Best Gene Model Blast : Link to GSTUMT00001713001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1128
TGTACAAAAAGTTGGAGGAAGACCCGGATGATGATGAGGAGTTTGAGGAT
GTTCCAGTTGAGGGCTTGAATAGATTACCGCACATTGAATCCCGCGATGA
TCGTGAAGGGAGCTATACGTACGATGTATTAGACGGCGCGGAGGCGCAGA
TGCTGAGGAGGGCAATTTACGAGAGCAAAAGAGAGCAAAATGGGTCGAAT
AACAAATGGAAGCTCTCGCCAGACCCGATTTCTGATACTAGTCTAGCTGA
ACCTACTAATCCTTTATTTCTTGGCGATGATGAACACTATGATGAGGACG
GGGACGACGATCCATTCCCATTGGACTTTGTCGGTGAGGGACAAGGTAGC
GATGAAGAACTGCAAAAAGCTATTCAGTTATCACTCGAGACCCATCGAGG
ATATCATAATACGGAGTTGGAATCAACCTTCTTTGGTCGCGATCTTAGTG
ACATCGCCGAAGAGGAAGAAGAGGACGAGCCCATTAATAATAAGGGCAAA
GAGAAAGCCATCGAGGTGCCTGCAGTGGAAAAAGAGAAGCCACTACTGCT
TGTAGTGCCTGGTGAGGATCCAGATTTCAGCAGAGCTATTTCTGAATCCA
GGCGTATGAATGGTGGTGACATGCCGAGGGATTCCGGCTGGGGCGCCCCT
GGTGAGAGTAGCAAGGGCTCCAGCTCTTCTGTTGTCCCGAAGAATCCCTT
TGGAGGATTGTTGCCATTTGAGCGTTTAGACATGGGCAAGAGTATGCTAT
TTAAAGGGAAGAACCCGGAGGGGGAACCTAAAGAGATGGGGGAGGGCGGA
GACAAGGGAGAGGATAAAAATGGAGGTGATTCTGTGCCACTACCGCCGTG
GTTCACTGGGGGTCCAAAAAAAGATCTAGCAGAAGAGATGCGCTTGGCTA
ATCGCGATAGGGAACTCACTCGAGAGGAGAAGGAAAGGCAGGAATACGAG
CTAGAGATGCAGAGGATTGCTAATAAGCGATATAAAGAACGGGATGTGGT
GATGATCCAA

Sequences in the Contig:

SY0AAA42YK22FM1 SY0AAC53YB17FM1 SY0AAD25YJ14FM1