Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1127
Length(NT) : 1787
Best Gene Model Blast : Link to GSTUMT00000653001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001213131.1| Score: 1794 E_value: 0.0
KEGG Definition: hypothetical protein
Accession: ang:An04g05320 Score: 1765 E_value: 0.0
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG1851 Score: 362 E_value: 6e-35
PFAM Definition: No Hit Found
Swissprot: P43583|BLM10_YEAST
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0008538 = Molecular function: proteasome activator activity
GO:0005515 = Molecular function: protein binding
GO:0043248 = Biological process: proteasome assembly
GO:0030163 = Biological process: protein catabolic process

Sequence:
>Contig1127
TTGGAGTGTTTGAGGATGGGAGTGATAAACACTGCCTCTGTCTCTTCTTT
GAGCTGATCATATGTAACTAATGCTAGCCCAAAGAAGAGACAGAGGCAGT
GTTTGAGGATGGGAGTGATAAACATCAACACCGCGCAACCGCAGAGATTC
TTGGAGCTCTTGTCAATGCATATAGAGACTCGACAGTCAAAAATCGGGAC
ATGATGTGGGCTCATGTATTTCCTATCGTCAAACGGATCTTTGAGGAGGG
CCTTACCCCCGAGAATTCCTCATACTGGTCGTCTTTCTTGCATCTTGTTT
TGCAAGGGAAGGACCTAAGGCGGTCATGGCCTATCTTGGAATGGTTAACA
AACTATCGACTGGACATGAATTCGAATGCGGCATTCAAAGAGAGTTCTAA
GATTCAGCTTCTGCAGCAATCTATTCAGGAAGCAGGCTGGCATTTCCGAT
TAGAGAAGCCGATCTTGGAAGACTTCCTGAAACACATTGACCATCCGTAT
AAAGGCAAGGGTTCAATCTTAACCATGGTAAAAAAAAAGTGGTAACTAAT
ATACACATGGGCAGGCGTGCGAGAGGCGATGGGACAGACCCTAGGGACCA
TTTATAGATCTAGACACCACGAGTCATACAAAAATGTGCAGTACCTCATG
GACACACAGGCCAGGGCATCCTCGGTTGGATTAACCCCTTACGGCCCGAC
TGAGGAATTTTCGGAAACGGTGCATAGCGTATTCAAACGACTGGAGCAGT
GGAGACATGAACGTACACCCGGACAACAATCGCCTTCATCATACACAGCA
GGAAGCAAGACGGTGTTATTATGGCTGGATACCACATTGTCCTCCCACGA
GTGCACACAATTGATACCATTCTTCCCCGATGTTTTCATGGGCGAAATGT
TGCACATGATGGACATTAAAGAGGATCCAGAGTTGATGTCTCTTGCTTAC
CACGTTTTCAGACATCTTCCAAATATTCCTCACCCATTCAAACAAGACCA
CAAATTTATTTCTGCGCTAATACGAATCGGGACAACCTCTCCACTTTGGC
ATCAGCGACTCCGTGTCCTAATTAACATGCAAGTAATATATTTCCGTCGT
CTATTCCTCATTACAGCCGAGGAAAAGGAGCGAATATTCACTTGTGTGTC
GACGATGCTTGAGGATCCGCAGTTAGAAGTTCGGATTGGGGCAGCGACTA
CGTTGTCCGGGATGGTTCGGTGTTCGCCGGTTAGGCTAAGACAGGGGATT
GTGCAGGAGCTGAAAAATAAGTTTACTAGAATGCTAGTTCGGAATCCTTT
GCCCAAGAGATCACCAGCAGGTACCCCAACTCCCGATTATACAAGGATCG
TTATCACCCGTCATGCGGCGGTCTTAGGTCTTGGTGCGCTTGTCCAGGCC
TTCCCGTACGCCTCTCCACCGCCCCTTTGGTTGCCGGAAGTGTTGGCCAC
ACTTGCAGTCAAAGCGGCGGCAGATCCCGGTATGGTTGGTAAAAGTGTCA
AGAGCGCCCTCGGGGAATTCAAGAAGACACGGCAGGATACATGGCATGTA
GACGTCAAGGCGTTCACTTCAGATCAACTAGAGGATTTGGAAGGAGTGCT
GTGGAAAAGTTACTTCGCATGAGAACCACGAGACAAAAAATAAAGTATTG
GTAGAAATTGCACCTGTCAATGCCTTGAAGGGCATATGAGACGAGAACAT
GGATTGTTTACTGGTGTAGCCCACCTCCCCCTTTGTCGATTAATTCTGTA
GATAGAATTAAGAAAAAAACCCCCGAAGTTTCCGACT

Sequences in the Contig:

SY0AAA42YK20FM1 SY0AAB47YO11FM1 SY0AAC19YK14RM1
SY0AAC23YG11FM1 SY0AAC48YH10FM1 SY0AAD10YA18FM1
SY0AAD20YD08FM1 SY0AAD3YM19FM1