Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1126
Length(NT) : 838
Best Gene Model Blast : Link to GSTUMT00006094001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: ankyrin repeat protein E4_2
Accession: gb|AAO25691.1| Score: 271 E_value: 3e-22
KEGG Definition: hypothetical protein
Accession: ani:AN1130.2 Score: 268 E_value: 4e-22
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0509 Score: 297 E_value: 8e-28
PFAM Definition: Ank, Ankyrin repeat. There is no clear separation between noise and signal on the HMM search Ankyrin repeats generally consist of a beta, alpha, alpha, beta order of secondary structures. The repeats associate to form a higher order structure..
Pfam Number: pfam00023 Score: 116 E_value: 7e-07
Swissprot: Q8NFD2|ANKK1_HUMAN

Sequence:
>Contig1126
TTGGACGGTGGCACAGTCCTACCATCGCGGGTCTTAATTTTTTAAGAGGG
AATGGAAAGGAAGGCAAGGCCTTCTTAACAATTCAAAAAAAAATGAAACA
AAAAAGGATGAAACATTCAGCGATGGCCCGAGTGCGGATAGTCCGCTCCC
CGCTCCTCTGCTTACCGACAGAGCTGATCCAACTAATTTCCACCTACCTC
CCCACAAAGACCATCTTCACCCTCCTCGCAACCTGCCGGTTCCTCTGCCA
CTCTCTGGCCCCACTAATCCTCGACAAGCTCCTCCACAACACTCCCAAGT
CCTGGGACTCGACATTCAGCTGGATACTGCTCAACTACTCTACCAAAGGC
CTCCTCCGTGCCCTCCAACCAAAAAACCGCAGCGGGGAATTCAACATAAA
CTACCAAGATAAAACCGGCGCAACATGCCTCCACGCGGCATGCAAAATGA
ACGACGCACTGACGCTGTACATTCTCTTGGACCACGGCGCGAAGCCGGAT
ATCTTTGACATCAACGGGGAAACACCTCTGCACTTTGCTGTCCAGTACGG
GCGCGAGAACGTGGCGAGGGTGCTGCTGCAGGAGGGTGCGGATCCGAACC
TTCGCAGTGTGGCCGGGGAAACTCCCCTTTCGTGGGCTGTCAAGTACGGG
TACGCGGGGATCGTTCGGGCCTTGATAGAGTACGGAGCGGACGTGAACCT
TCGGGTTGGGAAGGGCGAGACGCCGCTGCACTGGGCCGCTGTACAGGGGT
TTGTGGAGGTTGTGGAGATTTTGCTATCGAGCGGAGCCCACGGGGAGATG
GTGAATTGGGAGGGGCAAACGGCTTTGTTGGTAGCGGC

Sequences in the Contig:

SY0AAA21YI12FM1 SY0AAA35YL11FM1 SY0AAA42YK09FM1
SY0AAA52YD17FM1 SY0AAA53YF23FM1 SY0AAB13YN06FM1