Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1125
Length(NT) : 1089
Best Gene Model Blast : Link to GSTUMT00006889001 E-value : 0.0
Numbers of ESTs : 11

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1125
TTGGGTGATTAGGAACTCGCGATTACCACAAAATGACTCTCCATTTGCTC
TCACTCCCGGCGGAAACGCTAGACTCAGTAACGACTTATCTTCCCCATCC
CGTCGATGCGCTGAACCTGTCCATGACCTGCCGTTATTTCAATCAGCATC
TGAGCACGCAACATAACAACAGGTTCTGGTACACAATGCTCGCCAACAGT
GAGGTGGCGCATACATATTTACCTCGCCCGTATCCAACCGGTAGTTCACA
ACCGGAGTATGATCCTACCCAGGATTACAAATCCTGGTATTTTGCGGGTC
TTGAAGTCGAACGGGTGTCAGTTTTGTTTAAAATCTATGGTGTCCTCCAG
CAGTTCATCAAACGGGGACTGGCGTGCGTGCCGAGTGCATGGACTCAAAA
TCTGCATGGGGTGCTTAAAGAAGCACAATACCACCATAACCAGATTCCAA
GGCCTAGGCCTAGACATCACCACTAACCCGCCCAGATCCAGCGTCACAGA
AATCTACTACCCAAGGCTCGGGCGCAAGATCCTCATGACCTACTACTGGA
GATTCGACATCGAATCGCTCTGCATCGCCCAGTTCGGAGTGGGCCTGGAG
CACCTGAAACGACGGAAGGAGGAGGAAAAGCTAGCCAAGGCAGCCTACAA
AAAGGCAAACCCGAGCCCACTTCGGAAGCTCCGCAATCAAGCCAAGTCTA
GTCTCGCCGAGGCCGCGTGGACCATCTGGAACGGGGAGGAGTACAGGTAC
CCCCGCGAGCGCTGGGCCAAGGACGTGACGAAGGAGCAGCTCCTTGCCTG
GCTGTTCCTGCGACAGGAAGACGATGAGCCGCAGAATGCCAACATCACCG
GGACCCTTGACCGCTACCTCAAGACCATCCGCAGCAAGGCTACTTTCGCC
GATAAGGACCAGGTGTGGTACGACTCTGTTGCCCGGGAATTACTAGAAGG
GCTGAAGGATCGGTATTCTGCCGAGGACGGGTATCGCAGGCTTGCATTTT
CTTGGCATGTGGAGAGGATTATCGATATCTACGAAAACCTTCCGTTTGAT
GATAGGCCGACCTTGTATCATTGCTGGTATGAGCACCCC

Sequences in the Contig:

SY0AAA42YK07FM1 SY0AAA61YA10FM1 SY0AAA8YJ10FM1
SY0AAB11YG04FM1 SY0AAB17YB02FM1 SY0AAB18YI07FM1
SY0AAB23YK07FM1 SY0AAB26YD05FM1 SY0AAB30YA03FM1
SY0AAB30YB24FM1 SY0AAB48YD17FM1