Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1124
Length(NT) : 1777
Best Gene Model Blast : Link to GSTUMT00004661001 E-value : 0.0
Numbers of ESTs : 54

Blast Results:

Nr Definition: hypothetical protein SNOG_07689
Accession: ref|XP_001798021.1| Score: 1810 E_value: 0.0
KEGG Definition: hypothetical protein [EC:4.1.3.1]; K01637 isocitrate lyase
Accession: ani:AN8755.2 Score: 1808 E_value: 0.0
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG1260 Score: 1146 E_value: 1e-126
PFAM Definition: ICL, Isocitrate lyase family..
Pfam Number: pfam00463 Score: 1566 E_value: 1e-174
Swissprot: Q12031|ACEB_YEAST
Gene Ontology:
GO:0005759 = Cellular component: mitochondrial matrix
GO:0046421 = Molecular function: methylisocitrate lyase activity
GO:0019541 = Biological process: propionate metabolic process
GO:0006567 = Biological process: threonine catabolic process

Sequence:
>Contig1124
TTGGATCGATTGGATCTTCCCAACGCCAAAAGCGTGAAATGCCTGCCCAA
TTTCTTCTTCGCCGCCCAGTACTGTGGCCGGTAAAGCTCCTCCCACGAAT
CCTTTGTGCGACGGCCCCCAACTCGACCCTGAGGATGCTCTCAACACACC
CTCCGAAGTCGGAAGACGAGGACGCGATATTCGCTGCCGGGGTCGAGGAG
GTGAAAAAGTGGTGGGCGGAACCCCGATGGAAAGGGATTGTTCGGCCCTA
CTCTACCGAGGACATTGTTAGCAAGCGAGGCACGCTGAAGCAGCATTACC
CGAGCTCGCAGACGGCCAGGAAGTTGTTTGAGTTGCTGAATGAGCGGGCG
GCGCAGGGGTTGCCGGTGCATACTATGGGCGCTATTGATCCCGTACAAAT
GACCCAGCAAGCACCGCATCTTGAAGCGCTATACGTGAGCGGGTGGGCTT
GTTCTAGTGTTCTCACAACCACGAATGAGGTATCACCGGACCTTGGGGAT
TACCCGTACAATACCGTACCGAATCAAGTCCAACGACTATTCAAAGCCCA
GCAACTCCACGACCGAAAGCACTATGACGAACGCCGGAGCATGACACCAC
AGCAGCGCAAGGAGAAACCGTGGGTAGACTACCTCCGCCCGATAATCGCG
GACGGGGACACGGGACATGGTGGACTATCCGCTGTGATGAAGCTGGCGAA
GCTCTTCGCCGAGAATGGGGCCGCAGCGATACACCTGGAGGACCAGATGC
ACGGTGGCAAGAAGTGCGGGCACCTGTCGGGCAAAGTCCTCGTGCCCATC
AGCGAGCATATCAACCGACTCATCGCGACGCGCTTCCAGTGGGACCTGAT
GGGCGTGGAGAACCTCTTGATCGCGCGAACGGACAGTGAGAGTGGAAAGC
TCATCAGCAGCACCGTCGACACCCGCGACCACCAATTCATCCTAGGCACA
ACCGCCCAGACCACTCCTCTCAGCGAAGTCCTCCAAAACCTCGAATCCAC
CGGCGCCCCGACAGAAGCCCTGGAAAGGGCGGAGGCAGCCTGGTTCGCAC
GGCACGAATTGACGACCTTCGATGATGCCGTCAAGTCCGAACTCGCCAAG
CTCCCCAACGCCCAGGCCAAGATGGAAGAATACATGCAGCACGCATCAAC
CCGCAGCAACACTGTCGCGCGGGAACACGCGCGCGCACTTCTCGGCCACG
AGATATTCTTCTCCTGGGACCTCCCTCGCACGCGGGAAGGCTACTACCAT
TACTCCGCCGGCCTCCCCGCTGCCATAAAGCGCGCACAGGCCTTCGCACC
CTACTCCGACCTCCTCTGGCTGGAGACCAAACGTCCATCGCTCACGCAAG
CAACATCCTTCGCCCGCACCCTCCTGCGCACCCCTTCCTCCCCGTCCGCA
GGCAAACACCTAGTCTACAACCTCTCGCCCAGCTTCAATTGGCTAGCGGA
GGGCTTCACTCCGGAGCAGTTGAAGTCCTTCATCTGGGACTTGGCGAAGG
AGGGCTTCGTGTTGCAAATCGTGTCCCTCGCAGGATTACACTCGGGTGCC
CTCGCTACCTGCAAACTCGCCACGCGGTTCAAAGATGAGGGCATGCTCGC
GTACGTCGACCTCGTGCAGAGGCGCGAGAAGGAGATTGGGTGCGACGTGC
TCACGCATCAGAAATGGAGTGGAGCGAATTACTTGGATGGGGTGTTGCAG
GCCGTGGCTAGCTCCTCAGCGACCAGCGCGGTTGGGGGGGATAGCACTGA
GCATGGATTTTAGATTGGGGGGGGACG

Sequences in the Contig:

SY0AAA33YC17FM1 SY0AAA42YJ03FM1 SY0AAC10YN20FM1
SY0AAC12YF13FM1 SY0AAC12YO20FM1 SY0AAC15YB14FM1
SY0AAC15YG14FM1 SY0AAC15YK14FM1 SY0AAC16YL18FM1
SY0AAC18YD17FM1 SY0AAC18YI03FM1 SY0AAC21YD19FM1
SY0AAC25YL04FM1 SY0AAC25YP07FM1 SY0AAC27YC02FM1
SY0AAC27YF23FM1 SY0AAC34YN02FM1 SY0AAC35YA02FM1
SY0AAC37YJ18FM1 SY0AAC41YO11FM1 SY0AAC42YC10FM1
SY0AAC46YD03FM1 SY0AAC46YG15FM1 SY0AAC49YJ21FM1
SY0AAC51YN05FM1 SY0AAC52YL12FM1 SY0AAC54YE04FM1
SY0AAC55YH15FM2 SY0AAC56YA10FM1 SY0AAC56YJ01FM1
SY0AAC58YJ13FM1 SY0AAC59YF08FM1 SY0AAC59YI13FM1
SY0AAC60YG17FM1 SY0AAC61YA03FM1 SY0AAC61YE08FM1
SY0AAC9YA15FM1 SY0AAD19YC18FM1 SY0AAD19YJ01FM1
SY0AAD1YN02FM1 SY0AAD24YH11FM1 SY0AAD25YD24FM1
SY0AAD27YI15FM1 SY0AAD32YF02FM1 SY0AAD34YF16FM1
SY0AAD45YK22FM1 SY0AAD49YB21FM1 SY0AAD50YJ10FM1
SY0AAD56YK20FM1 SY0AAD59YH07FM1 SY0AAD59YN15FM1
SY0AAD5YA01FM1 SY0AAD5YE05FM1 SY0AAD60YF06FM1