Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1123
Length(NT) : 689
Best Gene Model Blast : Link to GSTUMT00007701001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein BC1G_02006
Accession: ref|XP_001559342.1| Score: 256 E_value: 7e-28
KEGG Definition: hypothetical protein
Accession: ncr:NCU03712.1 Score: 202 E_value: 2e-22
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1123
TTGGCTCACCCACGAACAATTGTTCTGAAACGGCATGTATGGACGGAGAA
CACATTTCGGATTTGGTCCACCAGCTTAACGATGTTGAGCTTGCGGTGCT
GTTATCACTGGTCGCTGGAAAGCACTGTATTCTGACGACAGAGCCAGAAT
GGCTTGGAGCTTTTGCGGCAGCAGATTGAGCTACTCGGGCCAGCCGTATT
TGGACTTACGGTGGCGACCGTTCAGTGCACTCCTGATACCACTCTTGACG
ATTTTATAGAACCGTTGCTATTCGACGAAACCCGACCTTCACCCTCCTCA
CATGGCATATCGCCTGTGAATAACCGTGAGTCTGGAGAATCCTACTTTGG
CACACGAAACCGCTCAAGCCTTTTACGGACCTCCTCACAGGGTACTCACC
ACGAGAGCACAAGTGGTATCCGTAAGCTTGCCAACATTATTATTGCACAG
GACCTCGATCTTGCAAGCAATCAGGTCCAGACTCAAGCATTAGAGCTTAT
CAGAACCAAACGATTCTGCACGAGCAAGAAAAACTTTCACTGTGCCCCCA
ACCGATTTCTCCTGATTGCTTTACTTGGAAAACCCAATGACGAGTCCAGT
CTTTCTAGCCACTTGTGTGATTACTTTTTCATTTCTCATCATCACCCCTC
TGACGAGGGATTCCCAGAGGTGGAGCGGGAAGTTGAGTC

Sequences in the Contig:

SY0AAA33YJ09FM1 SY0AAA42YI22FM1 SY0AAB26YO24FM1
SY0AAC30YC02FM1