Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1122
Length(NT) : 1359
Best Gene Model Blast : Link to GSTUMT00005392001 E-value : 0.0
Numbers of ESTs : 14

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG1924 Score: 133 E_value: 2e-08
PFAM Definition: Drf_FH1, Formin Homology Region 1. This region is found in some of the Diaphanous related formins (Drfs). It consists of low complexity repeats of around 12 residues..
Pfam Number: pfam06346 Score: 116 E_value: 1e-06

Sequence:
>Contig1122
TTGGCACATCGCGATGAGCTTGGGTACGAGTACTGTGTGCCCTAACAGCA
CAGTGGAAGGCGGAAAGCAAGGAGAAGGAAAAAATTAGAGAAACCTGCAC
AACATAATTTGACAAAGGGGAAATCGGGACTCAGACACAGCGCATGAGAT
CAAAATGGGAAAGCCATCAAGCAGAAAGTTAGGGGAAAAAAAAAAAAACT
TGAATGAAAATGAAACAACTAGCTACATCAAAAGTTCCCATCTCACACGA
TACCGATACCTATAATACGTACCTACTCGCGTGCCCACCTCTATCCACCT
CCTCCCCGAACAAACACCATACCACCCACGCCGGAGAGGAAAAACCCACC
CTCCGAAACCTTACCCGCCCTCTCTCACGCTTATTCCTTCGCACTCTTCT
TCACACACAGACAAAACACAACCTCTTTTGTCTAAAGGATAAAAAAATAA
AAATAAGAAACCAAGAAGGATTACAAGCAATCATGTCGACCACTCCGACA
GCCGCCACTACAGCCCCCACCACCACCTCCGTCCCCCAGAGTCCCAGAGC
AGAACCACTCCAATCCCACTTCGCCAAACTCGCCCAAGACCCCATAACCA
CACACCTCACAGACACGAACGCAATCCCCATCCTGTCTACCCATCCGCAG
CCCTCCTCGCCCGGCCTCTCCTCGCTTTCGTCCGCCTTCGTACAGGCACA
TGACACAGCTTCCAGGATGGGGCTGGGAAAGCCGCTGCGCGTCACGCTGG
CGACCGCTTCCGGGGCGGCGGTGATCCAGACTGCTACAGTCGATGAGGGG
AGTGGAGGTGGCGGAGGGGAGGAAGGGGTTGATTATGTTGGTGGTGGAAG
TTCTGGTGGGGGAGGGGGAAGAGGTGGTGGTGGTGGTGGTAATGGTGAGA
TGCTGGTTGGGACGGTGATTGCTAAGGTGGATAGATTGGCCGAAGCGAGG
ATGGTTAGCTGGGGTGTCGAAGAGGTTGCTCGGAGGTTTCAGAAGAGTGC
TGCGGGTGATGGGTTATAATCCGCTCTCGGCCTGTGGAATGAGATGAGAT
TGATGACGGCCTGGTGGTCATGTTAATAACATGCCACTTTTTCCACTTTA
CTTCTCTTGCAGTTTTTAACACTTTCCTCTCTTCTTCCCCAAATATGCTT
TCATACACGGTGGCTAAGTAAGCAAGGATGTAATGAGGTGGTTTGCCCGT
TTGCCCGTTTGCCGTTTCATCATCATCGCGCTGTATCGGTATAATTATTC
GGCGTTTTTTCTTCTTTTCTTCTTTTCTTCTTTCCTTTTTCCTTTTTCCC
AACAGCAAATAACCCTTTACAACCGTTATTTACCTGCTGCTTACTATTTA
TTACTCCTA

Sequences in the Contig:

SY0AAA12YJ13FM1 SY0AAA13YI01FM1 SY0AAA25YG17FM1
SY0AAA40YG09FM1 SY0AAA42YI19FM1 SY0AAA63YB01FM1
SY0AAB50YB20FM1 SY0AAC28YM19FM1 SY0AAC34YI18FM1
SY0AAC45YM18FM1 SY0AAC52YF11FM1 SY0AAC52YL03FM1
SY0AAC6YM08FM1 SY0AAD29YD07FM1