Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1121
Length(NT) : 560
Best Gene Model Blast : Link to GSTUMT00007704001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001213983.1| Score: 415 E_value: 3e-39
KEGG Definition: hypothetical protein
Accession: ani:AN2479.2 Score: 411 E_value: 4e-39
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG3216 Score: 421 E_value: 2e-42
PFAM Definition: Acetyltransf_1, Acetyltransferase (GNAT) family. This family contains proteins with N-acetyltransferase functions such as Elp3-related proteins..
Pfam Number: pfam00583 Score: 162 E_value: 2e-12
Swissprot: P79081|ATS1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig1121
TTGGCATGCTTCGAGAATCCATTTCATCCATTATTATGGCTGGTCGGGTA
ACTGTGCGTGCCGCCGTAGCTTCAGATATACCAGTGATTCTGGAGATTAT
TAAGGAGTTGGCGCTTTATGAGAAAGAGCCAGACAAGGTACTCGCTACCG
AGGAAAGCTTGCATGACACACTGGGGTTCAAGGAGGGCTCAAAGTGCTAC
GCGAAAGCCCTATTATTGTATGAGGGCGACGAGCCAGCCGGAATGGCGCT
GTACTTCAACAGTTATAGCACATGGAGGGCTAAGCCTGGAATATACCTGG
AAGACCTGTTCGTAAGGTCTCAATTTCGCGGAAAGGGATATGGCACAACG
CTCTTAGCGGCCCTAGCAAAAGAGGTATTAGAGATTGATGGGGCGAGACT
AGAGTGGAGCGTTCTTAAGTGGAACGAGCCGTCAATAAAGTTTTACGAAG
GAATCGGCGCAACGAACCTAGGCAAGGAATGGCAGCAGATGAGGGTAGAC
GGGGATGCTTTAGAGAATTTGGCTAGAAGAGGTGTGTTTGGAGACGGAAA
GTGAGCGAAT

Sequences in the Contig:

SY0AAA42YG09FM1 SY0AAB36YH04FM1 SY0AAB38YC12FM1
SY0AAB53YK10FM1 SY0AAB61YB16FM1