Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1120
Length(NT) : 1419
Best Gene Model Blast : Link to GSTUMT00004008001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: DNA-3-methyladenine glycosylase
Accession: ref|XP_752146.1| Score: 460 E_value: 9e-44
KEGG Definition: DNA-3-methyladenine glycosylase, putative [EC:3.2.2.-]; K01249 DNA glycosylase
Accession: afm:AFUA_4G06800 Score: 460 E_value: 4e-44
KOG Definition:
Classification: [Replication, recombination and repair].
Kog Number: KOG1918 Score: 309 E_value: 6e-29
PFAM Definition: HhH-GPD, HhH-GPD superfamily base excision DNA repair protein. This family contains a diverse range of structurally related DNA repair proteins. The superfamily is called the HhH-GPD family after its hallmark Helix-hairpin-helix and Gly/Pro rich loop followed by a conserved aspartate. This includes endonuclease III, EC:4.2.99.18 and MutY an A/G-specific adenine glycosylase, both have a C terminal 4Fe-4S cluster. The family also includes 8-oxoguanine DNA glycosylases. The methyl-CPG binding protein MBD4 also contains a related domain that is a thymine DNA glycosylase. The family also includes DNA-3-methyladenine glycosylase II EC:3.2.2.21 and other members of the AlkA family..
Pfam Number: pfam00730 Score: 199 E_value: 4e-16
Swissprot: P22134|MAG_YEAST
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0003905 = Molecular function: alkylbase DNA N-glycosylase activity
GO:0006307 = Biological process: DNA dealkylation

Sequence:
>Contig1120
TTGGCACCTCTTGTCCTCCTCCCCAACGGTGCGAGGGGGATAAGCGTGGA
CAAAGACCGGTAAGCGCTCTACTCGTACCATGCCATGTACGAGTAGGGTA
CCGTACAGTAATACCCCATCGTATCTGGAGCCCCCGGCAGGAAATCGTCT
CACGGCAACCACCAGAATAGCAAGGGAAGCCGTCCAGCTTTGTCATATTG
GTCAACCTCACAGTTTATTACTCGCCTCGCACCTCTTGTCCTCCTCCCCA
ACGGTTAGACTACCGAACTGAATTCCCAGGCTCAGGTTCTCGAAGCTCAA
ACAACTGCCCCTTGCACTTTAGAGTTTATTTATCGCCAATATTCTCATGA
GATCTTAAAATAATTAGTTATTCATCGACAGGCAGGCTCCACGAACGATC
TTACTGGGTCGAGCTCAAACCACACCCTCATGGGACTGGATGCGGTGCAA
CGCGTTGTGTCTGAATCATCCCGGCCTGGGGACCTGGCCTCGAGTCAACG
GACCCCACAAGCTTGGCGCGGCCTCCTTTCTCTTTCTTTGGGAATCCTCA
TCATACCCGTACCGGTACCCAACTGTCCCCAGCTCTTCTAAAGCTACGGT
AAGTTGCCCCCTCAACCATCATCGCCGGACTTTCCAAGCCTGATAAAAAT
ATCCGTTCCAATGGTCGCCACTACACGCTCAAAAACGAACGGCGCCATCG
CAAAGGTGCTGAGCGCTTCCAAGGCTGGCGTTACGAAGCGGACCAAGTCA
TCTTCAGCTGGTGGCAAGAAGCCCGTTTCAACTAAGAAGTCGACACAACT
GCCCGTTGCAGGGGTAGCGAAAGAGAGACCTGCGTCGCCGCACGGCACCA
ACGCACCGTTAATCGCCCCTCGGGCAAACAGCACCGCTGTCCTACCCATC
AAACAACATGCACCCGCCACAACAAACACTATCCTCGGCCAAGCAACCGC
ACATCTTCTCTCCGTGGACCCAAGCCTAAAGTGGCTTATCGAATCCCACC
ACTGCGGGATATTCTCGGCAGAGGGCTTAGCAGAACTCGCCGACCCCTTC
CAAAGCCTTGTGAGCGGAATAATCTCGCAACAGGTCTCGGGTGCCGCCGC
CCGCACAATCAAAACCCGCTTCATAGCCCTCTTCGCTCCAACCCCCACGT
GTCCGCAGCCCTTCTTCCCAACGCCGGAAATGGTTGTAGCATGTCCGAAC
GATAAACTACGATCCGCTGGCCTCTCTGGGAGAAAAGCTGAGTATGTGGT
TTCTCTTGCGGAGCACTTCATCGACGGCACACTCTCGCCGGAAGTCCTCT
CTACGGCGCCGGATGCAGAGGTCATCGAGAGACTGACAAGGGTCCGCGGC
ATCGGGAATTGGTCTGCTGAGATGTTCCTGATGTTCGGGCTGAAGCGAAT
GGATGTTTTTTCCACGGGG

Sequences in the Contig:

SY0AAA42YF22FM1 SY0AAA49YG06FM1 SY0AAB44YO24FM1
SY0AAC31YK14FM1