Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig112
Length(NT) : 1816
Best Gene Model Blast : Link to GSTUMT00002502001 E-value : 0.0
Numbers of ESTs : 104

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig112
TTGGGTGACACTACCAACAACAACAACGACAACAACAAACAACGGAAACC
CTCTCTATACAATATATATATATATATAGACTACCCCTCGAAGTTTGGAA
CATTCACAATCCCAAAACATCCTTTAACACAAAAATCCTTTACTACTTTC
TTACCTAGAAAGCTACCGACTACTGATCATCCCTTCAGCCATTCTATCAA
ACCGTCAAACTGAAGTACCCAAACATTAAGAACTCCTCGAGCAATTCACT
TGTTCAACCCACCGAGCCAGCCGAAATGTCCCACTACGCGGTCCATACCG
TTAACCCCTACCGGGGATCCACAGGCACTCTTGCCATGCCCCATTCCGCT
CCTCGCAGCGGTCAGATGGTTCCCATAAACCCCCCCTCCCCGGCCGAGTC
TACCTGCTCATCCTGCGATTCTTCGCTCCCACTCAATACCCCCTGGTCTG
GGACCCCGACTTCTTCAACCACTTCTGTTTCTACTCACCACCATCCTCAC
CACCCTAGCCGCCCACGAAGACAGTCCATCAGTGATGGTGTTAGGATTGT
TGAGGCTCCCCGCATGTCAGCGGATGGCCGCCCTCCTCCTATCGTTGTTC
ACAGACGGCCCCCTGTGCCATCTCCCCCGCCAACCTCTCGATCACTGAAT
GCTTACCACACCGAATCCAGAGCCCACGGTACCTACCGTGGCGATCGCGC
TCTGCTTGTACCTGCATCATCTGGTCGTGATCGTCGGCGACGGGACTCCA
TGTCCGGTCCGCTCTCTGCGGGAGCACTTGCTAGCCACGGATACACTAGA
TATTACAAGTCAATCGATATCCAGGATGATCATGAAGGCAATGCAGACGG
TGGAATCGGTCGACGAGGCCGCACCAGGTTTCCACGGAAGCTTGTGAGCA
AGGAAGCCGTTGAGGAGATGGGACTGCCATGGACTGAAGACCTGGACGGA
TGCATTGTCGTCCTGCGAGCACTCGGTAGGACCGAAATCGAGAGATTGGT
GGATCTGACGGAGGAGATCCGACGTCGTCGTCACTCAACCGGCAAAGCGG
TCTCCTTCGAAGAGAAGACTATAATCCACGAAGCCCCACCCTACGTACCA
GAGCCACCCCCGGTTTCCGGTGCCACAGTGCGCCTTAATTCTGATCACTC
TTCGCACCGTATTTCCAAGACTGTCACTACAACTACCACCACCACATCCC
CAACTTTCGGACCAACAGGATTCATCGGATTGCCCGGGTCTTCGCAGGAG
AAGCTAGCGAGAGCTGAAGAGAAGGCTGCTAGAGCAGAAGATAGAGCAAC
CAGATTAGAGGAGAGGGCAGAGATCACCGGAAGGGCGAAAGATGAGCATG
AAGCTTTCAAAGCGAGAGCCAAAGCCCAGGAGAAGCAGCGTAAAGTTGGA
GAGACGCTGCTGAAGGAGAAGGTCAAGATGGAAGAGAGGGAGAGGTCTGA
GAGGACATTAAGGTTTCAGAGGGGTGATGGCCGGGGGAATGTGGTTGTTC
TCAAGTAGTCTGCGTTTAGAATGCTTTTTGATTGTGAGGCACTTTGTTAA
TTTTTTTCGGATTGTTTTCCCTCGCTGTTGCAGCCATTTGGTGTTTTCCT
TTATCGTTTTTGTAACTGTTGGAGTTGTCATTTTACATTTTATCTACTTG
TTGGGGTAGCCACGGAAGCATTGCATGCGCTCACACTTGTTCCTTGCACT
GCACTCGAGTACTTGATGATAGTGTTTCGTAGCATCTTGTTTAGTATCCG
ATGTACGTTAACGGGTATTTGCGGTGTTGTTGGGAATTGAGAACTCGGAT
TGATTTTTTCTATCAT

Sequences in the Contig:

SY0AAA12YF11FM1 SY0AAA14YD23FM1 SY0AAA18YG13FM1
SY0AAA18YM07FM1 SY0AAA18YO04FM1 SY0AAA18YO04RM1
SY0AAA1YG10FM1 SY0AAA20YK13FM1 SY0AAA22YA05FM1
SY0AAA22YL06FM1 SY0AAA23YN19FM1 SY0AAA23YN19RM1
SY0AAA23YP09FM1 SY0AAA25YM24FM1 SY0AAA25YM24RM1
SY0AAA26YI15FM1 SY0AAA27YM06FM1 SY0AAA27YP10FM1
SY0AAA30YB06FM1 SY0AAA30YE10RM1 SY0AAA32YA06FM1
SY0AAA32YF10FM1 SY0AAA32YF10RM1 SY0AAA32YK09FM1
SY0AAA32YK09RM1 SY0AAA32YK11RM1 SY0AAA33YH23FM1
SY0AAA33YL08FM1 SY0AAA34YJ16FM1 SY0AAA34YP17FM1
SY0AAA35YC01FM1 SY0AAA35YM16FM1 SY0AAA38YB20FM1
SY0AAA38YG03FM1 SY0AAA38YI24FM1 SY0AAA40YK04FM1
SY0AAA41YC06FM1 SY0AAA41YE20FM1 SY0AAA41YJ09FM1
SY0AAA41YJ13FM1 SY0AAA43YG01FM1 SY0AAA44YE03FM1
SY0AAA44YP14FM1 SY0AAA46YK11FM1 SY0AAA4YA24FM1
SY0AAA4YD24FM1 SY0AAA52YP09FM1 SY0AAA53YO19FM1
SY0AAA54YD17FM1 SY0AAA56YE01FM1 SY0AAA57YB11FM1
SY0AAA57YH24FM1 SY0AAA57YJ04FM1 SY0AAA57YL18FM1
SY0AAA58YA23FM1 SY0AAA58YD06FM1 SY0AAA58YJ03FM1
SY0AAA61YB19FM1 SY0AAA61YH08FM1 SY0AAA61YM07FM1
SY0AAA62YH19FM1 SY0AAA63YA19FM1 SY0AAA63YE19FM1
SY0AAA63YL01FM1 SY0AAA63YO01FM1 SY0AAA6YJ07FM1
SY0AAA6YO06FM1 SY0AAA8YD23FM1 SY0AAB12YH24FM1
SY0AAB18YB19FM1 SY0AAB1YE11FM1 SY0AAB1YI06FM1
SY0AAB1YP22FM1 SY0AAB21YE20FM1 SY0AAB25YO21FM1
SY0AAB30YD08FM1 SY0AAB30YE21FM1 SY0AAB31YE12FM1
SY0AAB32YB20FM1 SY0AAB34YJ03FM1 SY0AAB36YI22FM1
SY0AAB40YM08FM1 SY0AAB42YL08FM1 SY0AAB44YA08FM1
SY0AAB44YK14FM1 SY0AAB44YN21FM1 SY0AAB45YC15FM1
SY0AAB45YH15FM1 SY0AAB46YI04FM1 SY0AAB4YD24FM1
SY0AAB50YN17FM1 SY0AAB53YP14FM1 SY0AAB54YJ08FM1
SY0AAB56YD07FM1 SY0AAB56YD09FM1 SY0AAB58YG16FM1
SY0AAB59YC14FM1 SY0AAB59YE02FM1 SY0AAB61YE11FM1
SY0AAB61YK18FM1 SY0AAB7YA11FM1 SY0AAB7YP05FM1
SY0AAD14YH15FM1 SY0AAD59YO02FM1